NationStates Jolt Archive


100 Top NS Posters [comments split] - Page 2

Pages : 1 [2]
Kanabia
09-05-2005, 14:32
I have holidays coming up soonish. I plan to begin my evil rise to power! or something. In other words, i'll spam a lot more then.
Legless Pirates
09-05-2005, 14:35
Can I be queen?
If you want. I don't mind
FairyTInkArisen
09-05-2005, 14:36
Enjoy, see where you came, and most importantly, appreciate the work I put into this :p

yeah, cause you did it all by yourself :rolleyes:


and w00t! 19 places up!
UpwardThrust
09-05-2005, 14:38
If you want. I don't mind
:p :fluffle: :fluffle: :fluffle:
Jeruselem
09-05-2005, 14:45
68th to 61st!

:) :D

Not bad!
Chikyota
09-05-2005, 14:49
Wow, there are a number of nations on that list from way back. I haven't seen a handful of them in so long I thought they'd been deated.
Pure Metal
09-05-2005, 15:03
yay almost on the list :D
Kellarly
09-05-2005, 15:11
Argh! so close, hmmmm, you lot just wait til my broadband is sorted out! :D
Jeruselem
09-05-2005, 15:18
yay almost on the list :D

At the rate you post, I'm sure you'll be there. :)
I just kind of crawl up the list, slowly at 2000 posts a year.
The Blaatschapen
09-05-2005, 15:23
Gah, I really need to post more to ever be in the top100. But congrats to Legless Pirates, the other NSer from my university :)
Von Witzleben
09-05-2005, 15:33
Wow. I'm on a list!!!
Roach-Busters
09-05-2005, 15:52
Almost there...almost...
Layarteb
09-05-2005, 16:04
<-- moving up!!!
Sanctaphrax
09-05-2005, 16:07
Tinky dear, thats been in since the first installment, because I did all the rest of them by myself;) (with slight help from Sdaeriji on the first)
FairyTInkArisen
09-05-2005, 16:08
Tinky dear, thats been in since the first installment, because I did all the rest of them by myself;) (with slight help from Sdaeriji on the first)
well i want some recognition dammit!! :p
Von Witzleben
09-05-2005, 16:10
Almost there...almost...
13000+??? Geez RB. You should find yourself a hobby that doesn't involve a monitor and keyboard.
Layarteb
09-05-2005, 16:12
13000+??? Geez RB. You should find yourself a hobby that doesn't involve a monitor and keyboard.

Hopefully it'll have 2 legs, long hair, and be female ;).

Just kidding RB.
FairyTInkArisen
09-05-2005, 16:12
13000+??? Geez RB. You should find yourself a hobby that doesn't involve a monitor and keyboard.
I bet i have a higher 'posts per day' http://67.18.37.14/html/emoticons/sleep.gif
Von Witzleben
09-05-2005, 16:16
Hopefully it'll have 2 legs, long hair, and be female ;).
Ah yuck!!! Better stick to the monitor and keyboard then.:D
Pure Metal
09-05-2005, 16:16
a big fluffle to Sanctaphrax for all the hard work, btw
Von Witzleben
09-05-2005, 16:17
I bet i have a higher 'posts per day' http://67.18.37.14/html/emoticons/sleep.gif
Well, if NSing ever becomes an olympic sport you can brag about that. :p
Roach-Busters
09-05-2005, 16:18
Hopefully it'll have 2 legs, long hair, and be female ;).

Just kidding RB.

She lives on the other side of the globe. :(
FairyTInkArisen
09-05-2005, 16:18
a big fluffle to Sanctaphrax for all the hard work, btw
i helped him........................
Roach-Busters
09-05-2005, 16:19
13000+??? Geez RB. You should find yourself a hobby that doesn't involve a monitor and keyboard.

If you can think of anything, let me know. ;)
FairyTInkArisen
09-05-2005, 16:19
Well, if NSing ever becomes an olympic sport you can brag about that. :p
w00t!
Sdaeriji
09-05-2005, 16:21
Tink and Neo-Anarchists look like they're going to be the next members of the 10,000 club.
Pure Metal
09-05-2005, 16:22
i helped him........................
:fluffle: :fluffle: fluffles to you too then :fluffle:
FairyTInkArisen
09-05-2005, 16:24
Tink and Neo-Anarchists look like they're going to be the next members of the 10,000 club.
ok, my new goal is to beat her to it!
FairyTInkArisen
09-05-2005, 16:24
:fluffle: :fluffle: fluffles to you too then :fluffle:
that's more like it :fluffle: :fluffle: :fluffle: :fluffle: :fluffle: :fluffle:
Roach-Busters
09-05-2005, 16:24
ok, my new goal is to beat her to it!

Her? I thought Neo-Anarchists was a him? :confused:
FairyTInkArisen
09-05-2005, 16:26
Her? I thought Neo-Anarchists was a him? :confused:
:confused: i dunno
Sdaeriji
09-05-2005, 16:30
Her? I thought Neo-Anarchists was a him? :confused:

I am fairly sure she is a her.
FairyTInkArisen
09-05-2005, 16:31
I am fairly sure she is a her.
me too
Sdaeriji
09-05-2005, 16:33
I think 3rd is probably the highest I'm ever going to get. Legless Pirates and Roach Busters both post way more often than I.
Von Witzleben
09-05-2005, 16:41
If you can think of anything, let me know. ;)
How about gaming? On the playstation. You'll still need a monitor. But at least you can loose the keyboard.
Von Witzleben
09-05-2005, 16:42
She lives on the other side of the globe. :(
Are you sure she isn't realy a 70 year old he who likes to chat up young boys on the net pretending to be a she?
Roach-Busters
09-05-2005, 16:44
Are you sure she isn't realy a 70 year old he who likes to chat up young boys on the net pretending to be a she?

Don't worry, I'm sure. ;)
Czardas
09-05-2005, 16:44
Lutton is most often on the spam forum, I believe.
Which explains the postcount.There's a spam forum???

*realizes that he is seriously missing out on postcount*
Czardas
09-05-2005, 16:46
Her? I thought Neo-Anarchists was a him? :confused:You could ask, but that's probably against NS etiquette. So you'll probably never know.

In fact, you'll never know even if self-proclaimed males or females really are what they seem to be. Here on NS, nothing is what it seems. [/deep mysterious voice]
Draconis Nightcrawlis
09-05-2005, 16:47
Woo-hoo!! Broke the top 40 :D
Czardas
09-05-2005, 16:49
I bet i have a higher 'posts per day' http://67.18.37.14/html/emoticons/sleep.gifUnfortunately we won't find out for a long time.

No, actually, that's not sarcastic, the profiles really aren't working. I post between 20 and 50 times a day, but unfortunately I didn't discover the forums for over a month. And I still don't post every day. Otherwise my postcount would be skyrocketing. :(
FairyTInkArisen
09-05-2005, 16:54
Unfortunately we won't find out for a long time.

No, actually, that's not sarcastic, the profiles really aren't working. I post between 20 and 50 times a day, but unfortunately I didn't discover the forums for over a month. And I still don't post every day. Otherwise my postcount would be skyrocketing. :(
last time i checked i was nearing 72 posts per day http://67.18.37.14/html/emoticons/sleep.gif
Haken Rider
09-05-2005, 17:01
last time i checked i was nearing 72 posts per day http://67.18.37.14/html/emoticons/sleep.gif
Madness, utterly utterly madness!
FairyTInkArisen
09-05-2005, 17:03
Madness, utterly utterly madness!where have you been?! i havn't seen you post in forever :(

:fluffle: :fluffle: :fluffle: :fluffle: (i know you're not keen on fluffles but i missed you)
Jordaxia
09-05-2005, 17:08
last time i checked i was nearing 72 posts per day http://67.18.37.14/html/emoticons/sleep.gif


heh. On another forum, I managed 100 posts per day :D

But then I burned out. To do that consistently... defies belief.

Do you not have Repetetive strain injuries in your fingers now? :D
FairyTInkArisen
09-05-2005, 17:10
heh. On another forum, I managed 100 posts per day :D

But then I burned out. To do that consistently... defies belief.

Do you not have Repetetive strain injuries in your fingers now? :D
yeah not necesarilly from typing though :p
Peechland
09-05-2005, 17:13
YAY for being in 82nd place!!!!

and................


Go LP!!!! w00t!

:fluffle: :fluffle: :fluffle:
Czardas
09-05-2005, 17:23
heh. On another forum, I managed 100 posts per day :D

But then I burned out. To do that consistently... defies belief.

Do you not have Repetetive strain injuries in your fingers now? :D100 posts a day?!!

Okay, in my maximum I jumped from 316 to 398 posts over a three-hour period. I really had only about two posts until late March. Then I had about sixty posts until late April. It's all my school's fault: they assign tests in waves, so you have 1 a week in each of six different subjects. :mad:

I just calculated...I've been around for 75 days and have posted a little more than 425 times = a paltry 5.67 posts a day. Well, I'll just have to start posting more often...
Kanabia
09-05-2005, 17:32
One day last December, I did over 200 posts.
Roach-Busters
09-05-2005, 17:35
One day last December, I did over 200 posts.

Holy poop on a stick! :eek:
Haken Rider
09-05-2005, 17:39
YAY for being in 82nd place!!!!

and................


Go LP!!!! w00t!

:fluffle: :fluffle: :fluffle:
http://67.18.37.16/423/87/emo/smiley.gif Go Peech!!! http://67.18.37.16/423/87/emo/smiley.gif

@Fairy: Schooltrip, Barcelona, double beds, guy sleeping on my pillow...
FairyTInkArisen
09-05-2005, 17:41
http://67.18.37.16/423/87/emo/smiley.gif Go Peech!!! http://67.18.37.16/423/87/emo/smiley.gif

@Fairy: Schooltrip, Barcelona, double beds, guy sleeping on my pillow...
sounds.............interesting...........hope you had a good time
Haken Rider
09-05-2005, 17:45
sounds.............interesting...........hope you had a good time
Meh, needed less horny dudes, more decent fast food.
Kanabia
09-05-2005, 17:49
Holy poop on a stick! :eek:

It was because I was running this "Most beautiful woman on NS" contest thread...I wasn't allowed to post a poll, so I had to keep track of everyone's posts, and because the thread was so popular, it got several hundred posts in less than 24 hours, as I recall. So in order to make it managable, I checked back every hour or so. In between vote counting, I was on other threads, and it just built up. :p

Of course, I was on holidays at the time.
Czardas
09-05-2005, 18:09
One day last December, I did over 200 posts.Not bad. By this summer, I'll have nothing to do for most of June (my school finishes in early June, but the work year for everyone else goes on until June 28) so you can expect similar improvements to my postcount.
Czardas
09-05-2005, 18:10
<snip>
Of course, I was on holidays at the time.Ah, that explains it...see post above.
The Blaatschapen
09-05-2005, 18:25
Lol, I'm still way below <1 post a day :)
Legless Pirates
09-05-2005, 18:28
Hopefully it'll have 2 legs, long hair, and be female ;).
Who? Me?
Czardas
09-05-2005, 18:51
Lol, I'm still way below <1 post a day :)Wow, I have more posts than you...How often do you go on NS?
Haken Rider
09-05-2005, 19:05
Wow, I have more posts than you...How often do you go on NS?
You'll need to wait at least one day to know the answer.
Czardas
09-05-2005, 19:09
You'll need to wait at least one day to know the answer.Then ask Blaatschapen to telegram me when s/he next goes on. Or wait, s/he won't be able to receive the answer until the next day.
The Blaatschapen
09-05-2005, 19:24
Wow, I have more posts than you...How often do you go on NS?

Everyday, but if you can find a post from me from before the Jolt Move I'd be surprised :)

I only posted twice on the old boards. And I'm in NS since 2002 :eek:

Even nowadays I don't post that much, but it's getting better :)
Aust
09-05-2005, 20:25
W00T!!! 99th place. Eat my dust all you -100ers.

Your next Mr Unchained. And then Tink...
FairyTInkArisen
09-05-2005, 20:27
W00T!!! 99th place. Eat my dust all you -100ers.

Your next Mr Unchained. And then Tink...
hahahhahahaha! you'll never overtake me! i'm heading straight for the top and that's where i intend to stay!






and i just realised, now i'm not in a mod sandwich anymore :(
Czardas
09-05-2005, 20:27
Everyday, but if you can find a post from me from before the Jolt Move I'd be surprised :)

I only posted twice on the old boards. And I'm in NS since 2002 :eek:

Even nowadays I don't post that much, but it's getting better :)Well, keep at it boy (girl?). Unless the postcount isn't that important to you. Hard to believe, but there are some crazy people like that, LOL.

*looks at own postcount* Great. Now I'm "Quite Deadly". What does that mean? I've never killed anyone. I'm innocent! *breaks down sobbing*
The Blaatschapen
09-05-2005, 20:29
Well, keep at it boy (girl?). Unless the postcount isn't that important to you. Hard to believe, but there are some crazy people like that, LOL.

*looks at own postcount* Great. Now I'm "Quite Deadly". What does that mean? I've never killed anyone. I'm innocent! *breaks down sobbing*

Obviously it's not that important me. If it was I had started 2 years ago and be the uberspammer by now ;)

And I'm still a 'member'. Hopefully I'll be something else soon.

Blaat

PS. I'm a boy :)
Vittos Ordination
09-05-2005, 20:31
I think I have passed LG, I am probably in 73rd now. I will be top 50 by June.
Xanaz
09-05-2005, 20:34
Perhaps it's my lack of "post count" but I think not. I find it rather, umm silly to even care about who has the most spare time on their hands to post. Or who make pointless posts that only waste bandwidth so that they may take some sort of weird pride in trying to show who has the most empty life on the forum via post count. Again, perhaps it's just post count envy, but I doubt it. ;)
Czardas
09-05-2005, 20:34
Obviously it's not that important me. If it was I had started 2 years ago and be the uberspammer by now ;)

And I'm still a 'member'. Hopefully I'll be something else soon.

Blaat

PS. I'm a boy :)Thanks for the clarification. Apparently it's not good netiquette to ask online people for their gender, age, name, whatever.

And when you get 400 posts, you become "Sometimes Deadly". 450 - Quite Deadly. 500 - Superior Gamer. 700 - Gaming Master. 800- Oh, what the hell, just look it up on http://forums.jolt.co.uk/showthread.php?t=392208, Euro's superb guide to just about everything in Gameplay.

~Czardas, Ruler of the Universe
Czardas
09-05-2005, 20:38
Perhaps it's my lack of "post count" but I think not. I find it rather, umm silly to even care about who has the most spare time on their hands to post. Or who make pointless posts that only waste bandwidth so that they may take some sort of weird pride in trying to show who has the most empty life on the forum via post count. Again, perhaps it's just post count envy, but I doubt it. ;)*very offended* I don't make pointless posts. My postcount comes mainly from sensible discussions about politics, evolution vs. creationism, and religion. Unlike some people...*looks very pointedly at the top end of the scale*


What? You're suggesting that I'm just posting this to increase my postcount?! That's a lie!!! GUARDS, EXECUTE THIS NSer!!
FairyTInkArisen
09-05-2005, 20:41
*very offended* I don't make pointless posts. My postcount comes mainly from sensible discussions about politics, evolution vs. creationism, and religion. Unlike some people...*looks very pointedly at the top end of the scale*


What? You're suggesting that I'm just posting this to increase my postcount?! That's a lie!!! GUARDS, EXECUTE THIS NSer!!
no no no, there'll be no executions! put him in my basement and chain him up, i'll be down there soon
Xanaz
09-05-2005, 20:43
*very offended* I don't make pointless posts. My postcount comes mainly from sensible discussions about politics, evolution vs. creationism, and religion. Unlike some people...*looks very pointedly at the top end of the scale*


What? You're suggesting that I'm just posting this to increase my postcount?! That's a lie!!! GUARDS, EXECUTE THIS NSer!!

Oh that wasn't per se directed towards you. Only the people who are actively trying to up their post count as if it actually means any thing of any real importance other than perhaps they should get out more. :D
Czardas
09-05-2005, 20:48
no no no, there'll be no executions! put him in my basement and chain him up, i'll be down there soonAnd what exactly are you planning to do to him?







Maybe I'm safer not knowing. ;)

~Czardas, Ruler of the Universe
FairyTInkArisen
09-05-2005, 20:50
And what exactly are you planning to do to him?







Maybe I'm safer not knowing. ;)

~Czardas, Ruler of the Universe
*gets out whip* oh.....nothing. *heads down to basement*
Czardas
09-05-2005, 20:50
Oh that wasn't per se directed towards you. Only the people who are actively trying to up their post count as if it actually means any thing of any real importance other than perhaps they should get out more. :DI should get out more before my postcount gets too high...



...




...



...nah, I can't be bothered.

~Czardas, Ruler of the Universe
Xanaz
09-05-2005, 20:55
*gets out whip* oh.....nothing. *heads down to basement*


Hahaha, in your dreams sweetheart! :cool:
FairyTInkArisen
09-05-2005, 20:57
Hahaha, in your dreams sweetheart! :cool:
hey! i'm in charge here! you'll do as i damn well say! sweetheart
Czardas
09-05-2005, 21:00
*gets out whip* oh.....nothing. *heads down to basement*Hahaha, in your dreams sweetheart! :cool:*puts head in hands* I should have known not to let Tink go down there. Not that something will happen to her. She'll just be too soft on him. ;) *wheels algometer down into basement*

*turns to face camera* "If you want something done right, do it yourself."

~Czardas, Malevolent Ruler of the Universe

...KYAHAHAHAHAHAHAHA!
Czardas
09-05-2005, 21:01
hey! i'm in charge here! you'll do as i damn well say! sweetheartSee what I mean?
Kreitzmoorland
09-05-2005, 21:02
*looks at own postcount* Great. Now I'm "Quite Deadly". What does that mean? I've never killed anyone. I'm innocent! *breaks down sobbing*"Quite Deadly" is the best one ever. I even stopped posting for a while so I could stay that way. So much for that effort.
Czardas
09-05-2005, 21:06
"Quite Deadly" is the best one ever. I even stopped posting for a while so I could stay that way. So much for that effort.It is? Oh darn. I'm getting really close to 500 posts, am in the middle of three discussions, and am helping all those newbies on Technical, just during a four-minute break between classes. :( Well, okay, not really. And I like "Quite Deadly", but I want to know what it means!

~Czardas, Inquisitive Supreme Ruler of the Universe
Xanaz
09-05-2005, 21:06
hey! i'm in charge here! you'll do as i damn well say! sweetheart

I don't think I'm your type.. unless you're into cat-fights if you catch my drift. :) hehe :D
FairyTInkArisen
09-05-2005, 21:10
I don't think I'm your type.. unless you're into cat-fights if you catch my drift. :) hehe :D
hey, i'll give anything a go once ;) :fluffle:
Xanaz
09-05-2005, 21:12
hey, i'll give anything a go once ;) :fluffle:

Don't tell people THAT! lmao! :D :eek:
FairyTInkArisen
09-05-2005, 21:15
Don't tell people THAT! lmao! :D :eek:
haha! lol! i think most already know it :p
Xanaz
09-05-2005, 21:18
haha! lol! i think most already know it :p

Well, then at least don't let them know where you live or like hand out your number. Haha, you're funny. :D
Czardas
09-05-2005, 21:21
This thread is rapidly degenerating. As Supreme Ruler of the Universe, I hereby decree:

1) No person, except a moderator or The Commonwealth of Czardas or other nations as said Czardas has allowed, is permitted to post in this thread until further notice.

2) That goes especially for two nations, The <insert nationtype1 here> of Xanaz and The <insert nationtype2 here> of FairyTInkArisen.

3) If anyone violates the two above rules, they shall be executed...no, that's too harsh...thrown in prison...wait I don't have a prison...tortured...that's against the law...given a time out...no, that's just stupid...well anyway, something REALLY BAD will happen to them. Like a suspension of chocolate chip cookies for the next 250 posts.

~Czardas, Supreme Ruler of the Universe
FairyTInkArisen
09-05-2005, 21:29
Well, then at least don't let them know where you live or like hand out your number. Haha, you're funny. :D i won't but those cards i put in the phoneboxes kinda had my number on..............maybe they won't know it's me...............


yeah, funny in the head :rolleyes:
FairyTInkArisen
09-05-2005, 21:44
This thread is rapidly degenerating. As Supreme Ruler of the Universe, I hereby decree:

1) No person, except a moderator or The Commonwealth of Czardas or other nations as said Czardas has allowed, is permitted to post in this thread until further notice.

2) That goes especially for two nations, The <insert nationtype1 here> of Xanaz and The <insert nationtype2 here> of FairyTInkArisen.

3) If anyone violates the two above rules, they shall be executed...no, that's too harsh...thrown in prison...wait I don't have a prison...tortured...that's against the law...given a time out...no, that's just stupid...well anyway, something REALLY BAD will happen to them. Like a suspension of chocolate chip cookies for the next 250 posts.

~Czardas, Supreme Ruler of the Universe
*locks Czardas in basement and steals cookies*
The Blaatschapen
09-05-2005, 21:55
Like a suspension of chocolate chip cookies for the next 250 posts.


250 posts. That's only an hour for tinky ;)
FairyTInkArisen
09-05-2005, 21:57
250 posts. That's only an hour for tinky ;)
:D
The Blaatschapen
09-05-2005, 22:01
:D

See, she does everything to get rid of the suspension quickly ;)
FairyTInkArisen
09-05-2005, 22:31
See, she does everything to get rid of the suspension quickly ;)
:cool:
The Imperial Navy
10-05-2005, 09:00
I've crawled up to 6! Rock on!
Texpunditistan
10-05-2005, 09:11
I've got almost 20,000 posts on a different message board I used to hang out at religiously. Just started up here the day before yesterday. :)
Sanctaphrax
10-05-2005, 13:04
Hows about we keep the spam down guys? Thanks a lot ;)
Czardas
10-05-2005, 13:08
*locks Czardas in basement and steals cookies*Not so fast. As Supreme Ruler of the Universe you pick up a few things. *escapes from basement, steals cookies back from Tink, and replaces them with explosives, all in 1000 nanoseconds (to avoid godmoding ;))*
FairyTInkArisen
10-05-2005, 13:09
Not so fast. As Supreme Ruler of the Universe you pick up a few things. *escapes from basement, steals cookies back from Tink, and replaces them with explosives, all in 1000 nanoseconds (to avoid godmoding ;))*
*cries*
Czardas
10-05-2005, 13:10
250 posts. That's only an hour for tinky ;)Okay, 2500 posts, or 10 hours.

And that if they're all just smilies. :p

~Czardas, Supreme Ruler of the Universe
Czardas
10-05-2005, 13:11
Hows about we keep the spam down guys? Thanks a lot ;)So this is spam?

Oh well...I TOLD YOU SO...

~Czardas, Supreme Ruler of the Universe
FairyTInkArisen
10-05-2005, 13:11
Okay, 2500 posts, or 10 hours.

And that if they're all just smilies. :p

~Czardas, Supreme Ruler of the Universe
I'll have to stay up all night catching up on all that!
Czardas
10-05-2005, 13:13
I'll have to stay up all night catching up on all that!*very coldly* Is that my problem?

~Czardas, Malevolent Ruler of the Universe
FairyTInkArisen
10-05-2005, 13:19
*very coldly* Is that my problem?

~Czardas, Malevolent Ruler of the Universe
:(
The Imperial Navy
10-05-2005, 13:21
:(

How dare you upset my friend!

*Blasts a hole in Czardas with a cannon*

:fluffle:
FairyTInkArisen
10-05-2005, 13:22
How dare you upset my friend!

*Blasts a hole in Czardas with a cannon*

:fluffle:
my hero :fluffle:
Kanabia
10-05-2005, 13:25
*blasts a hole in thread*

:D
The Imperial Navy
10-05-2005, 13:26
*blasts a hole in thread*

:D
Yarr harr! Burn it all down! Burn it all! YAR HARR HARR! :D
Jeruselem
10-05-2005, 13:27
* Looks for the Spamtastic thread hole plugger *
Czardas
10-05-2005, 13:27
Are you aware that all you are posting here is spam?

Oh wait, all I'm posting here is probably spam as well. So forget that.

~Czardas, Supreme (but slightly perforated) Ruler of the Universe
FairyTInkArisen
10-05-2005, 13:28
Are you aware that all you are posting here is spam?

Oh wait, all I'm posting here is probably spam as well. So forget that.

~Czardas, Supreme (but slightly perforated) Ruler of the Universe
yeah, i'm just waiting for Sanc to tell me off on msn for it
Czardas
10-05-2005, 13:29
* Looks for the Spamtastic thread hole plugger *I have it. :D

*repairs thread*

*repairs himself*

*blasts TIN into deep cyberspace*

*gets deleted by the mods and protests because it doesn't say anywhere that you're not supposed to kill people on General ;)*

~Czardas, Supreme Ruler of the Universe
FairyTInkArisen
10-05-2005, 13:31
I have it. :D

*repairs thread*

*repairs himself*

*blasts TIN into deep cyberspace*

*gets deleted by the mods and protests because it doesn't say anywhere that you're not supposed to kill people on General ;)*

~Czardas, Supreme Ruler of the Universe
actually i think you'll find killing people could be seen as flaming....
Czardas
10-05-2005, 13:34
actually i think you'll find killing people could be seen as flaming....However, as Supreme Ruler of the Universe, I can resurrect people from the dead.

Or I can submit a request to the mods. It's the same thing.

~Czardas, Supreme Ruler of the Universe
Czardas
10-05-2005, 13:35
*restores TIN but forbids having any cookies until 20,000th post*

*eats all cookies*

*steals key to basement*

~Czardas, Supreme Ruler of the Universe
FairyTInkArisen
10-05-2005, 13:38
*kicks Czardas in the shin*
Kanabia
10-05-2005, 13:39
* Looks for the Spamtastic thread hole plugger *

*plugs Jeruselem*

C'mon Sanct, get angry already...
Jeruselem
10-05-2005, 13:46
*plugs Jeruselem*

C'mon Sanct, get angry already...

Look we don't want this thread to be leaking posts to other threads do we? :)
Czardas
10-05-2005, 13:47
*kicks Czardas in the shin*Okay, so killing people is flaming but kicking them isn't?

*sh—no, str—no, st—no..."does something really bad that's against the law" to a player whose name starts with the letter "F" and ends with the letter "N" and contains a "T" as the fifth letter*

~Czardas, Supreme Ruler of the Universe
Kanabia
10-05-2005, 13:49
Look we don't want this thread to be leaking posts to other threads do we? :)

Sure we do! :D

And sorry about the plug. Damned if i'm going to reach in there and remove it though.
FairyTInkArisen
10-05-2005, 13:58
Okay, so killing people is flaming but kicking them isn't?

*sh—no, str—no, st—no..."does something really bad that's against the law" to a player whose name starts with the letter "F" and ends with the letter "N" and contains a "T" as the fifth letter*

~Czardas, Supreme Ruler of the Universe
oh............who's that?
Kryozerkia
10-05-2005, 14:35
lol I have never heard of the top 3.
BLASPHEMY!!
Czardas
10-05-2005, 15:38
oh............who's that?*grins* Take a wild guess.

~Czardas, Supreme Ruler of the Universe
The Imperial Navy
10-05-2005, 15:43
Man you truly are evil... WOOP WOOP WOOP! WOOP WOOP WOOP! WOOP WOOP WOOP! WOOP WOOP WOOP!

-TIN, Most insane person in the Universe.
Czardas
10-05-2005, 15:48
Man you truly are evil... WOOP WOOP WOOP! WOOP WOOP WOOP! WOOP WOOP WOOP! WOOP WOOP WOOP!

-TIN, Most insane person in the Universe.Are you referring to me?

How dare you call me evil! I'm not evil! Only evil people are evil! GUARDS, KILL THIS NSer!!! KYAHAHAHAHAHA!!!

~Czardas, Malevolent Ruler of the Universe (and 2nd most insane person)
The Imperial Navy
10-05-2005, 15:56
Are you referring to me?

How dare you call me evil! I'm not evil! Only evil people are evil! GUARDS, KILL THIS NSer!!! KYAHAHAHAHAHA!!!

~Czardas, Malevolent Ruler of the Universe (and 2nd most insane person)

*Phone rings* It's for you!

*Smack Smack Smack!*

Oh, you have a call on the other line!

*Smack Smack Smack!*

~TIN, most Insane person in the Universe, and Vying for Czardas's job.
Czardas
10-05-2005, 16:01
*Phone rings* It's for you!

*Smack Smack Smack!*

Oh, you have a call on the other line!

*Smack Smack Smack!*

~TIN, most Insane person in the Universe, and Vying for Czardas's job.Unfortunately, to become Supreme Ruler of the Universe, there are a few qualifications that you must fulfill:

Your NS ID must be Czardas;

You must have the same number of posts as I have;

You must have a DNA genetic code running CGAATTAGCATGATACATAGATTCAACAGGATAACACAGGATAGGTATTTGGGGGGGAACACAATTAAGAGAGGCGGCCTCGATTACGATAGATATCTAT AGCTATATCTGATCTAGCTATCTACGCGATCTAGCTAGCTTCTAGCTAGCTAGTCGA...*

*The first portion of the bases on my 1st chromosome

~Czardas, (Still) Supreme Ruler of the Universe - Ha ha!
The Imperial Navy
10-05-2005, 16:05
Nah-I just opened a dimensional gateway to a universe where I do rule. MWAHAHAHAHAHAHAHA! Bring me Carrot juice!

~TIN, supreme ruler of an Alternate Universe
The Imperial Navy
10-05-2005, 16:10
Well, it is time for me to set my sails and head for home. Goodbye, Captain Cactus!

~This has been TIN, ultimate Life form of the Universe. The best, the wisest, the wackiest, and the bestest.
Aust
10-05-2005, 16:20
*Uses unknown power to hit both TIN and Czardas round the head, then walks off.*

-Aust, The baby of the top 100...But a damm powerful baby
FairyTInkArisen
10-05-2005, 17:23
*grins* Take a wild guess.

~Czardas, Supreme Ruler of the Universe
............nope............can't think of anyone....
Sanctaphrax
10-05-2005, 17:28
I'm not on MSN Tink, but I'll gladly do it here if you want;)
Just kidding, I will however ask the mods to split this topic, leaving only the first post.
FairyTInkArisen
10-05-2005, 17:40
I'm not on MSN Tink, but I'll gladly do it here if you want;)
Just kidding, I will however ask the mods to split this topic, leaving only the first post.
well get on msn! i need to cry to someone about my horrible new haircut :( :(
Andaluciae
10-05-2005, 17:45
Wow, I'm on the list...
Cogitation
10-05-2005, 17:55
I'm not on MSN Tink, but I'll gladly do it here if you want;)
Just kidding, I will however ask the mods to split this topic, leaving only the first post.How about I just lock this and grant you permission to repost the topic? I think that's easier for all concerned.

--The Modified Democratic States of Cogitation
Cogitation
10-05-2005, 18:06
Yeah, I think that's what I'll do.

iLock. Sanctaphrax, you may repost this as a new topic.

--The Modified Democratic States of Cogitation