A Crisis Of Secession (Completely, 100% Open, with guidelines and manageable realism)
Generic empire
05-05-2005, 21:54
http://usera.imagecave.com/mobrule132001/GINNLogoImproved.bmp.jpg
“Good evening, and welcome to GINN news. Tonight, violence in Buchiana continues following the detonation of fifteen high explosive devices, believed to be carbombs, in the city of Port Belgrade, capital of the Imperial province of Buchiana.
http://usera.imagecave.com/mobrule132001/carbomb.bmp.jpg
Following the conclusion of the Buchianan war for independence and the destruction of the Buchianan armed forces five years ago, the province has seen an ever growing underground movement, led largely by the Buchianan Liberation Army, commonly known as the BLA. Despite the best efforts of the Imperial Intelligence Services, and the Generian Civil Enforcement Division, the province of Buchiana has slipped ever farther away from the order of the Imperial government, and popular opinion has increasingly twisted towards the side of the BLA terrorists.
Late yesterday evening, a team of masked gunmen stormed the Imperial Generian Diplomatic Liaison Offices in New Bucharest, and seized fifty-four diplomats and staff members as hostages after executing the guards. The siege has continued for just over nineteen hours, as Imperial military and special police tactical teams attempt to negotiate the release of the hostages. However, the hostage takers have consistently refused to agree to any terms, and it is only a matter of time before the building is stormed, or the terrorists execute their prisoners.
http://usera.imagecave.com/mobrule132001/hostages.bmp.jpg
In related news, an operation to capture the influential BLA commander Nikolai Mareki’ev was reported failed by an Imperial army spokesman. Mareki’ev is believed directly responsible for planning and coordinating the carbomb attacks last week that killed over 1,800 people.
Following this statement, the Imperial government released a second statement declaring their consideration of deploying the Imperial 40th army to deal with the growing crisis. However, they stated that these measures will only be taken if a full provincial rebellion begins.
That’s all for tonight. For GINN international, I’m Gregor Katyanovic.”
----------------
Imperial Diplomatic Liaison Building, Port Belgrade
The masked men looked around anxiously, training their AK-47s and MP-5s on the heads of their blindfolded, kneeling prisoners. They had been holding the building for nineteen hours, and they knew it was only a question of how long before the Imperial special forces got tired of the game and stormed the compound. When that moment came, they knew that they would not hesitate to fight and die for their cause: independence for Buchiana, and freedom from the tyranny of the Emperor. Still, they wanted to make sure they had accomplished something before that final hour came.
In a small, central room on the third floor of the building, a group of masked fighters worked to set up the tripod and digital video camera, connecting it to a laptop computer that sat on a nearby desk. Using the power of orbital television satellites and the world wide web, they would broadcast a message to Generia and the world.
“We are ready, Dmitri.”
“Good.”
“Are you going to put your mask on?”
“No. I want the world to see my face.”
A young man with a short beard and fiery, passionate eyes stepped in front of a striped blue flag draped over a wall.
“Alright, roll it.”
The red light on the camera flicked on, and the man behind the tripod flicked a thumbs up. Dmitri stood straight, and stared into the lens, a hard expression on his face.
“To the government of Generia, and the citizens of the Empire who slave under her cruel totalitarian regime, my name is Dmitri Kac. Under my command, fighters of the Buchianan Liberation Army have seized your diplomatic liaison building in New Bucharest, and taken as hostages fifty-four slaves of this corrupt bureaucracy. I have already made my demands to the Imperial government: that they begin an immediate withdrawal from the free land of Buchaina, and grant full independence and autonomy to her people to form their own government and constitution. However, the Imperial government has shown little sign of being willing to comply with these reasonable demands, and in their greed for power, have doomed themselves.
Realizing the futility of trying to discuss terms with these animals, the BLA has decided that we shall no longer negotiate with the Imperial government, that wants nothing but suffering and oppression for the people of Buchiana, and so therefore, war is the only plausible solution. To the Imperial Government, I issue a warning. You have brought the fury of hell upon yourselves. You would do well to take this opportunity to withdraw before it is too late, and too many of your numbers have fallen. You are not invincible, and you will be stopped. Your fortresses and your cities and your armies shall provide you no security until freedom for Buchiana is attained. You will learn to fear us as you watch the endless stream of bodybags flowing from the battlefields. Consider this an official declaration of war against your corruption and dictatorship.
To the International Community, I beg your support for our just and noble cause. I ask you to send all that you can to aid our struggle against our brutal foe. Let them know that their age of tyranny will not last forever, and that the many can feel the sting of the few.”
Another masked man burst into the room, causing the heads of the others to snap towards his frantic figure.
“Hurry! They’re coming!”
Kac looked back to the camera.
“The BLA will prevail, and Buchiana shall be free. There shall be no mercy for the soldiers of the tyrant.”
Gunfire exploded outside the door, and the BLA fighters grabbed their guns. Kac remained focused.
Long live the free republic of Buchiana! Long live Nikolai Mareki’ev! Victory to the BLA! Death to tyrants!”
As he screamed this last warcry, Imperial special forces burst into the room, gunning down everyone inside. However, they were too late. The transmission and the BLA’s message had already made its way over the wires and airwaves of the globe. As an Imperial soldier moved to turn off the camera, charges ripped through the structure, and everyone inside was engulfed in flame in an explosion that leveled the entire compound.
------------------
Official Imperial Statement
The Imperial Government, under orders of Emperor Antonius I, magnificent ruler of the great Generic Empire, having heard the declarations and seen the violent terrorism of the BLA and their supporters, hereby declared its full intention to eradicate this secession movement, that poses such a threat to the innocent lives of Generia and the stability of the Empire.
The Imperial 40th army, under the direction of General Vlakar Nriv’ka, has been mobilized and ordered to deploy to the province of Buchiana to put an end to the rebellion, and bring final stability to the region by any and all means necessary.
Though we have utmost confidence in the abilities of General Nriv’ka and the Imperial Generian Armed forces, we request that any nations interested in deploying their own forces to aid in operations do so. The Imperial government will periodically be issuing open contracts to involved parties to be completed for monetary rewards. The Empire thanks all supporters of this crusade to rid her land of BLA hate and terrorism. God be with us all.
Generic empire
05-05-2005, 21:55
((OOC: It’s very simple. The Generian province of Buchiana has rebelled, and the Imperial foothold has broken. The 40th army has been sent in to reclaim the province and crush the rebellion, and a request for support has been extended from both the Buchianan Liberation Army (BLA) and the Generian Imperial Government.
The Rules:
1) This RP is open to any and everyone who wishes to join, as long as they are of at least decent role-playing caliber. May 2005 nations are just as welcome as January 2003 nations. I want to seek as much a balance between new, fresh RPers and old, experienced ones as possible. We shall not discriminate based on nation age and population.
2) I want this to be as balanced an affair as possible, both to keep things manageable and as much fun as possible for everyone who wants to get involved. Therefore, no one shall be permitted to deploy more than 200 soldiers, be they peacekeepers, special forces, pilots, or frontline grunts. Remember that no matter who you choose to support, the small BLA guerilla movements and militias, or the large, brute-force oriented Imperial army, you will find advantages. This is not a numbers war, and is intended to focus highly on smaller, specialized operations occurring beside large campaigns and full-scale operations. If you manage to lose a huge majority of your forces, you may request via TG to me, or in the soon to be posted OOC thread to reinforce your numbers, and I may or may not permit it based on the situation and status of IC events.
3) There will be no godmoding, as I assume you assume. This rule is self-explanatory. If you believe that Godmoding has or is occurring, discuss it over a messenger service, through NS telegrams, or for larger issues, in the soon to be established OOC thread, where these rules will be reposted. I ask that everyone be reasonable and realistic in their combat losses and other related statistics.
General Information:
First off, as I said, this is not intended to be a numbers war on the part of the nations who intervene or involve themselves in the conflict. The situation should call into use the full extent of your wit and wile, your high technology (no FT please), along with any understanding (or lack thereof) of military tactics. The Imperial 40th army is of course going to be using the full extent of her numbers and general brute force, but there will also be specialized operations being undertaken on behalf of the Imperial government by the Imperial special forces units, and the Generian Imperial Intelligence Service (GIIS).
The BLA, though it may not look it, is in nature a balanced foe for the Imperial army. Though they do not currently have the supplies needed to wage extended war against their numerically superior foe, with outside covert involvement on their behalf, their competent commanders and willing following will be able to run a guerilla, and in some cases an overt war for independence. It is the job of the interventionists to supply and aid the BLA in target elimination in order to give them that extra edge they need.
On the other hand, the Imperial army, while larger and more technologically capable, is very much a hulking beast. It should be the initial strategy of the rebels to target the mobility and later the morale of the Imperial army, to eliminate the overwhelming advantage of numbers, thus forcing the Generian government to wage a smaller scale war on the level of the BLA rebels. Still, the men of the 40th army are hardened soldiers, and will fight hard. Their leaders are some of the brightest military minds in Generia, and will go to whatever means necessary to secure victory in Buchiana. They are never to be underestimated.
There will often be contracts issued by both sides and possible third parties for assassinations and specified operations, in order to keep things moving along. When these contracts are issued in an IC fashion, claim your OOCly and ICly. They will be granted on a first-come first-serve basis. Please respect prior claims to these contracts and specific operations, as I realize good posts take time to write.
I am also looking for one or more parties wishing to play the roles of international reporters covering the conflict. The setting is perfect kindling for war crimes and atrocities, so having the press on the scene would definitely make things more interesting, and give the Imperial government a headache.
I aim for this to be a return to at least my memories of the NS glory days, and thus am taking care to organize this properly with these initial guidelines and explanations. I’ve seen a lot of talk in the forums about boredom and anger at the state of NS affairs, and so I hope to do my part to bring a small bit of amusement back to II. Now, ladies and gentlemen, with no further ado, let the games begin.
*These terms are subject to additions, which will be posted and highlighted in the OOC thread.
Generic empire
05-05-2005, 22:06
A Map of Buchiana:
http://usera.imagecave.com/mobrule132001/Buchianamap.bmp.jpg
Kroblexskij
05-05-2005, 22:15
TAG- adds to RP PACT
The Island of Rose
05-05-2005, 22:17
To: Emperor Antonius I
From: Sergei Ilyanov, First Chancellor of the Chancellory of Foreign Affairs
Ah Antonius, another rebellion? Well don't worry friend, I'm going to see if
I can talk to Wilhem to send some helicopters and Rosktai down there. Maybe
a Fleet too, Naval support is always nice. Also, you know Rose City's always
open for you incase things go wrong. I'm sure this help would be welcome,
but I just want to have this approved. Also, don't worry about the Imperial
Congress approving this. It's not a declaration of war per se, it's merely a
police action. Plus the Generians and Rosians don't have to know about this,
so you can have full credit. I'll be expecting a reply soon, Comrade. God be
with you.
Sergei Ilyanov
Foreign Chancellory
Generic empire
05-05-2005, 22:20
The OOC thread:
http://forums.jolt.co.uk/showthread.php?t=417194
Flaming Souls
05-05-2005, 22:20
Tag, can't get involved right now due to work.
McLeod03
05-05-2005, 22:20
Tag for later post
Generic empire
05-05-2005, 22:23
To: Emperor Antonius I
From: Sergei Ilyanov, First Chancellor of the Chancellory of Foreign Affairs
Ah Antonius, another rebellion? Well don't worry friend, I'm going to see if
I can talk to Wilhem to send some helicopters and Rosktai down there. Maybe
a Fleet too, Naval support is always nice. Also, you know Rose City's always
open for you incase things go wrong. I'm sure this help would be welcome,
but I just want to have this approved. Also, don't worry about the Imperial
Congress approving this. It's not a declaration of war per se, it's merely a
police action. Plus the Generians and Rosians don't have to know about this,
so you can have full credit. I'll be expecting a reply soon, Comrade. God be
with you.
Sergei Ilyanov
Foreign Chancellory
encrypting...
transmitting...
Official Imperial Statement
To: Sergei Ilyanov, First Chancellor of the Chancellory of Foreign Affairs, TIOR
From: Emperor Antonius I, Generia
Of course I and the Empire appreciate the support, and will accept it most readily. i shall take measures to put you in touch with the Imperial commanders on the ground, and the GIIS liaisons to bring you up to date on the situation, once your forces are deployed in country. At the moment, the Empire has managed to maintain her foothold on the northern territories, and Fort Lew would be a perfect place for your men to set up a staging and preliminary deployment area. The Empire thanks you, old friend.
Emperor Antonius I,
Sovereign Imperial Lord of Generia
Dracun imperium
05-05-2005, 22:36
With the morning coming closer and closer, the Dread Lord's eyes came closer and closer to sleep and just as he was about to fall asleep he was reawaken at 2:00 A.M. in the morning but Imperator Shimara. Oh great what now, he thought to himself. He quickly dressed himself in the appropriate dress and made his way down with the Imperator to the conference room where Supreme Commander Adrian already was conversing with several trusted aides.
The Dread Lord trusted no one but the Supreme Commander and the Imperator, and for lots of reason, but he was in no mood to go back in time, he was needed at the present.
"Lord Bane, information has come in from the Generian Province of Buchiana that they are rebelling against our ally of Generia. We can not allow this to occur. If it continues it can lead to secession and then later chaos in the province, this cannot occur." One of the Supreme Commander's aides reported.
"Do not dare tell me what can occur and what cannot occur!" His voice booming in the late night, "Second of all I am the Dread Lord, not Lord Bane, get it right!" After several minutes of stunned silence the Imperator spoke, since he was the only one brave enough, "My Dread Lord, this is a definite operation that can increase our standings with Generia even more so then they already are."
"Very True my Imperator, alright authorize an operation, have the Ultra Carrier Dominance be sent off for the province. Make sure that the Ultra Carrier is fully prepared to re-stock over and over again."
"Yes, Dread Lord."
"Alright I'm going to bed."
***
The Dominance prepared for the long journey to province of Buchiana. It was loaded with over 200 troops, and then some. It was prepared for a long and treacherous operation, and sure enough it would probably be just that. It would be under command of Commander Varkin, who was infamous for his sheer brutal tactics and punishments.
"Commander Varkin, we are ready to leave on your orders." an officer announced on the bridge.
"Understood Officer Tenvar, alright let's set sail for war, make way." Varkin Barked.
"Sir, yes sir!"
***
Message to the Generic Empire,
We are sending aid immediately to help you end this disgusting excuse for rebellion. We have stood together on several occasions, and we shall only add this to the list my dear friend.May the Imperial Gods rain their anger down upon these separatists. They will not last long under our combined might!
The man looked and acted like any other tourist on vacation. He in reality was a member of a covert operations team that had had been assigned to find and aid the insurgents and disrupt the imperial forces.
He stopped by a local backalley tavern and began making subtle inquries on how to find the nearest member of the resistance.
The Infinite Crucible
05-05-2005, 22:42
It was close to three in the morning. The storm had intensified and small rivers could be seen running along the street. The wonderful stars and bright moon were obscured by inky black storm clouds that cried acid rain. The lights of the Xeno Affairs building lobby shown out on to the streets of the Imperial City. Dr. Violet had just finished a long day of work and was leaving the building when a car pulled up. Our ran two soldiers and a short messanger. The messanger's trench coat was instantly slick with rain. In his hand was a plastic bag with a DvD in it. On this DvD were last words of a patriot. The messanger handed the bag to Dr. Violet.
"Minister of Xeno Affairs, sir, I think you should see this!" the short man whose name had been forgotten spoke as he handed the DvD to Dr. Violet.
"How dare you come to me like this, have you seen this video?" Dr. Violet inquired, this man was not authorized to see such things. Before the messanger could respond, Dr Violet pulled out his gun and shot him in the gut. In another quick flick of the wrist he shot the other two guards. Blood flowed down the street and small hunchbacked men emerged from the dark to clean the mess. These men had violated a high law, and were given a merciful punishment.
Dr. Violet returned to his office and played the DvD.
"Well what do we have here," he said with a terrible smile.
Verghastinsel
05-05-2005, 22:44
Emil Dresner was drunk. Again. He was also in Buchiana, again, which is not a good place to be drunk, especially at night-time, which it was. He'd been in this situation before, and it had ended badly.
Currently, Emil lay face down in an alley, in a puddle of undoubtedly the dirtiest rainwater in the Generic Empire, whistling quietly to himself.
A Generian voice called out of the darkness "<Stay where you are, mate, and you'll walk away from this with both yer kneecaps>"
Emil barely knew the language whilst sober, and in his present state had no comprehesion of what had been said to him.
"Urb..." he mumbled, rolling onto his back.
Again, the voice, "<I SAID STAY WHERE YOU FUCKING ARE!>"
Emil could see a shape, a two-legged shape at that. He dragged himself onto his knees.
Suddenly a gunshot blazed in front of him, and time seemed to move slowly for a second...
<"STAY DOWN, YOU BAS...">
In that second, Emil was on his feet. He wasn't drunk any more. Nothing sobers you up like being shot in the leg. Training took over, and Emil grabbed, twisted, and heard the man's wrist break. The gun was in his hand now, and the barrel was under the mugger's chin.
<"NO! PLEASE!"> He yelled.
BLAM
The corpse sagged, and Emil let it go. He knelt beside it and ripped away part of the man's shirt to staunch the flow of blood from his leg. As far as he knew, he hadn't killed anyone for the last eight years, since he left the Republikanischer Schutz. There was that Praetorian last year, but he would've lived, wouldn't he?
Probably not, come to think of it.
"...Fuck" said Emil, as the dull thump of distant explosions entered his ears, and the screams rang out over the city...
OOC: Emil Dresner, drunken ex-Republikanischer Schutze (Verghastinsel's Republican Guard, an elite division formed of *minimum* ten-year veterans from the Verghastinselheer), is in New Bucharest. He is angry, hungover, and damn well armed and dangerous. Emil is currently carrying a Generian G-93 .45 ACP pistol, and a battered, sawn-down Verghastinsel Armaments KS12 Self-Loading Shotgun. Oh, and he's been shot in the leg. Which means he's REALLY angry, rather than being just 'normal' angry.
Generic empire
05-05-2005, 22:58
encrypting...
transmitting...
Official Imperial Statement
To: Dread Lord Bane of the Dracun Imperium
From: Lord Varus Tiberius Alexei
Emperor Antonius sends his thanks for your offer or support, and will accept it most readily. The Imperial army is still largely in control of the northern tip of the province, and suggests Fort Lew as a suitable staging area for your operations in-country. We shall put you in touch with the necessary authorities.
Lord Varus Tiberius Alexei,
Loyal Servant to Emperor Antonius I
Doomingsland
05-05-2005, 23:10
tag
The Island of Rose
05-05-2005, 23:42
The 71st Rosian Battle Fleet. Twenty five ships made by the Hamptonian Defense Corporation ready to bombard anything with missiles and cannon fire. The flagship, a Rose Class Carrier, was capable of hold one hundred and twenty five aircraft. Helicopters, transports, fighters, fighter-bombers, anything. You name it. All of them approaching the outside of the Port City of New Buchrest. But their mission was not the obvious boom and puff that you would expect from such a large fleet.
Their mission was merely a supportive one, they were to provide devices such as light artillery, IFVs, APCs, tanks, Humvees, anything that could help. They were to provide their own special strikes too, since missiles can do that you know. But who are the people they were going to support?
The obvious answer would be the Generian 40th Army, but that wasn't it, no. The Chancellory of Defense approved, without the Imperial Congress' watch, the sending of five men, Rosian Special Forces aka Rosktai, to go into the province and help the 40th Army... stabalize the place. Right now they were on their way to Fort Lew on board of a Chinook. Armed with the ROICW-1A and the Hamptonian designed AIBS (Advanced Integrated Battlefield System) equipment, aka a fancy Land Warrior Thing, they were ready to take on any kind of situation. But who were the men.
The first man was Major Roy Johnson. A former American, rare for a Rosian, he was tough and was involved in many conflicts, including the last Generian conflict the Imperial Commonwealth was involved in. He was going to be the leader of the three other men. He was thirty three, old really for a soldier. But young for a Major, I suppose. He had a nice tan, every Rosian does and was a very cautious man, never to rush into things. Of course, the blasted man leads four other men into battle.
The second man was Colonel Johann Lancer. A former Severan citizen, he joined the Rosian Army as soon as he joined the Island and had a good record ever since. Twenty seven, he was also a bit young and a bit aloof at times. But when it came time, you know you could depend on him.
The third man was Staff Sergeant Jose Menendez. A Cuban, he joined the Rosian Army as soon as the Island gained control of the Havana Province. He already had prior experience with the Cuban Army and was put on the Rosktai as an experiment. He had a strange sense of humor, finding anything funny, anything. But of course if he had to kill a man, well, nothing would stop him. He'd probably laugh too. The man is twenty nine.
The fourth was Staff Sergeant Anthony Cornoti. A Greek by birth and Rosian citizen by law, he joined the Rosian Air Corps, but got bored. He then transferred over to the Army, this is the adult version of ADD. Absolutely nothing can keep his focus, except briefings and shooting. I think that's why the Air Corps bored him, they just defend the Island... which nobody invades... at all. He was twenty two, so he was rather young you know. Heck as we speak, he was looking at the Lew Valley, bored no less. They have pills for that kid.
The last was Staff Sergeant Robert Faw. The youngest and the stereotypical cocky man of any squad. He grew up in Roska City where crime is usually the highest, and after surviving fifty drive bys you'd get cocky too. He was twenty one. Young eh? That cocky boy.
And all of them was on that sole Chinook, all arrived at Fort Lew excited, scared, or both.
Generic empire
05-05-2005, 23:48
The 155mm guns thundered on the border, hurling shells at positions hundreds of kilometers away. The explosions lit up the night sky and the roar echoed over the mountains and through the ancient stone walls of the Alexian pass. Under cover of this bombardment, Imperial ST-29 main battle tanks and GFV-1 APCs rumbled through the pass, flooding out into the northern province. The Imperial 40th army was on the move, preparing to initiate the first part of the campaign against the BLA.
Imperial GIF-1 fighters roared through the skies over Fort Lew and New Bucharest, where advance elements of the Imperial mobile rifle divisions had begun making themselves at home, awaiting the arrival of the rest of the army.
The blades of an green camouflaged GH-2 gunship kicked up black dust as the bird neared the helipad within the confines of Fort Lew, the largest Imperial military base in Buchiana, and the designated staging point for all future Imperial operations within the province. General Vlakar Nriv’ka threw open the side door, and stepped onto the ground as the engine noise began to fade. The stiff wind produced by the rotors caused his grey overcoat coat to flap forward and up, and he rushed towards the large nearby building to find shelter from the gust.
Stepping inside, he straightened his coat and ran his fingers through his thin grey hair, making himself look once again like the respected Imperial military officer he was. A general’s aid seemed to materialize out of the air before him, and offered a starch salute.
“Sir, if you’ll follow me, I’ll show you to your office.”
Nriv’ka spoke gruffly to the young man.
“Screw my office. Take me to the command room.”
The aid brushed it off, accustomed to lack of respect from the generals.
“Of course, sir. Right this way.”
The General stepped into the large, noisy room, full of blinking lights, flashing screens, and large maps of the operational theater. The room smelled of cigarette smoke and coffee, exactly the way he liked it.
“Sir is there anything else I can do for y-“
“Get lost.”
The aid hurriedly saluted, and made himself scarce. Nriv’ka clasped his hands behind his back, and threw his chin up. An officer calmly walked up to him and saluted.
“General Nriv’ka, sir. Colonel Josef Jaroslav, base commander.”
Nriv’ka returned the salute.
“Get me up to date.”
“Sir, the deployment is progressing as planned. The northern territories are locked down tight, and the BLA doesn’t have the means or the manpower to attack the armor we’re bringing in here. Troops are flowing in by helicopter and C-130 into the northern garrisons. We should be ready to commence full scale operations in a week.”
“Colonel, we don’t have a week. We’ve got to hit these BLA bastards before they start getting any funny ideas about taking the fight to us. I want us ready to move in four days. The Black Guard units are in country or not?”
“Yes sir, they deployed this morning. Good. We’ll start operations tomorrow night.”
“Of course, sir. Also, Laszlo Slavochka, the GIIS chief, arrived earlier this afternoon.”
“Hell! Those pricks don’t know when to keep their noses in their own shitpiles. Keep an eye on that bastard. I don’t want GIIS screwing this up.”
“Of course, sir.”
The Colonel saluted, and rushed off to take care of business. The General fastened his eyes on the live satellite feed displayed on the large monitor in front of him. He began to focus all his energies on the task ahead.
((OOC: More coming.))
Doomingsland
05-05-2005, 23:51
OOC:Post coming tommorow.
Borman Empire
05-05-2005, 23:56
Tag
McLeod03
06-05-2005, 00:04
<Four nautical miles from coast of Buchiana>
The dark tiled hull of the HMS Adept breached the black surface of the sea, moonlight glinting off the puddles on her conning tower. Black shapes swarmed in a trained professional manner from a hatch on her foredeck, towing large bundles behind them. In less than a minute, two inflatable boats were floating off the submarines hull, and paddling slowly towards the distant shoreline. In them were two squads of commandos, one from the infamous NSOC unit, and another from the elite Night Stalkers. Armed with a variety of weapons, they were to make contact with Buchianan forces, and lead guerrilla attacks on Imperial supply lines.
Generic empire
06-05-2005, 02:31
Imperial soldiers rushed about on the darkened helipad as the chinook touched down. The doors opened, and five soldiers, all foreign, stepped out onto the concrete. An officer wearing Generian insignia and the mark of a Captain approached, and saluted. He addressed them in English punctuated with a slight accent.
"Welcome to Fort Lew, gentlemen. I am Captain Mikhail Gregorev. Colonel Jaroslav has requested on behalf of General Nriv'ka that I bring you inside immediately. Please follow me."
The officer turned sharply on his heel, and walked briskly towards the large headquarters building. Once inside, he led the men down a flight of stairs to a lower level briefing room.
"Please, have a seat. The Colonel will be in shortly."
The officer exited the room, closing the heavy steel door behind him. The sound of an automatic lock was clearly audible. Several minutes later, the door once again opened, and a middle-aged officer, again wearing Generian insignia, walked into the room. He stood before the men, and offered a polite salute. He too spoke in near perfect English.
"On behalf of General Nriv'ka, welcome to Buchiana and Fort Lew. This base will serve as your staging area for the duration of your time in Buchiana, so make yourselves at home. General Nriv'ka regrets that he cannot conduct this briefing personally, but as I'm sure you understand, he's got alot on his plate. Now, let's get down to business. Major, the lights if you please."
The room went dark, and a map of Buchiana was projected on the wall beside the Colonel.
"As you can see, the northern strip of the province from the northern garrisons to the Deska river is secure. Advance units have the roadways under heavy patrol, and I'd be very surprised if the BLA managed to get enough men up there to do any significant damage to our supply convoys or troop and armor columns. However, I'm afraid the same's not true for the rest of the region. Fort Lew is currently holding the front down here on the edge of the valley. Everything south of us and everything east of the Deska river is hostile territory, and I wouldn't advise anyone to travel the roads north of us without an escort."
The map switched to a series of satellite photographs.
"From what we can see, the BLA's been very busy, building training camps, and fortifying outposts all over the province, and from what we can see, they're getting ready for a war. Now, we've been shelling the hell out of the enemy's positions all along the area between this fort and the northern garrisons, but again, I wouldn't be surprised if they've still got some lurkers hanging around, directing operations against our convoys. If they're really feeling ballsy, they might even try to launch an attack on the garrisons, but at this stage in te game, I doubt they have the manpower or the gear they need to do that."
The map changed again to a different series of views.
"As you know, right now we're working on getting our armor and full infantry cotingent in country, through the Alexian pass. Until we get our boys fully deployed, our armor and striking capacity is going to be severely limited, and we're going to have to concentrate everything we've got on playing defense down her on the lines and up north around the garrison. That's where you boys come in."
The screen flipped to a series of images, photographs of known BLA operators.
"These are low level BLA operatives and commanders. Small timers compared to some of the big fish we know are lurking throughout the rest of the province, but still a thorn in our side until we get rid of them. Most of them are known or strongly suspected to be running around north of us, in the gap between us and the garrisons. They've probably infiltrated the villages, and the small towns, and I'll bet you a dime to a dollar most of the roads between here and the secure zone are booby trapped.
These guys range from money launderers to demo men. Nothing serious, but like I said, a thorn in our side. Now, I can't spare anyone to go take these guys down, but GIIS has been kind enough to loan us some intelligence on their whereabouts and suspected operations. I'll be uploading that data directly after the briefing to make it available to you. Most of these guys have token cash bounties attached to their heads, nothing extravagant, but then again, I hear you boys fight for God and country."
The screen flashed off, and the lights came back up.
"Rules of the game are simple, boys. You pick a target, you go in, and you get 'im. We'd like it if the target was still breathing when you brought him back to us, but if you've got to kill and verify, so be it. Just make sure these nefarious characters can't keep running around causing trouble. Some of them will be dug in with the civvies in the villages or the towns. We can't verify which of these towns are still loyal to Generia at this time, so do what you can to minimize collateral damage. In other words, don't go levelling an Imperial soldier's grandma's house, or some shit. Clear? Good. I'll get the target list uploaded in a minute, and you boys can pick and choose as you please. For your size squad, I'd say no more than one contract at a time. I'd also say to get some rest. You've got a long campaign ahead of you."
The Colonel saluted once again, and strolled out of the room, followed by the major.
((OOC: Official Imperial contract list batch one coming up soon.))
The man, officially going by Darel Steat, began talking to those in the town in the Buchiana province. He made inquires into the nature of the BLA and where he could find members or those who could lead him to members, his accent marking him as a man not from the Generic Empire.
Generic empire
06-05-2005, 03:43
((OOC: Theao and the other BLA supporters, I'll post a BLA man setting you up for a meeting with a local commander tomorrow, after I finish compiling the contract list for the Imperial Army.))
Pres Seth read the beaten piece of paper, although he was barely able to make out the words through the dirt and grime that covered it. It had obviously been smuggled out through a very dirty process.
It was a short note begging for help by the resistance against the Generic Empire.
"sir," one of his generals began, "it goes without saying that we don't have the forces to aid directly--"
"Yes, but there are other methods," Seth replied, he then turned to his intellgence officer, "convertly give as much economic aid to these people as possible."
"Sir if I may be so bold," the officer began a smile forming on her lips, "we do have the excess money from the ore imports......."
"Excellent idea, send it over, along with some beef and pizza, god knows we have enough of both. As for you," Seth said turning to his diplomatic officer, "I want you to send a message to both sides saying that Letharn would be more then happy to offer nuetral grounds for any peace talks."
"Will we actually," the battle hardened diplomat asked.
"Yes, nothing would be better then a peacful arangement, also" at this point his voice took on a slightly different tone, "spread out or intelligence from the embassy as much as possible. It may be neccessary for us to take more direct action. But let me be clear no excutions without direct orders. We aren't going to kill anyone in this, unless he's a war criminal."
++++
Five hours later there were thirty members of the Letharnese foriegn service (LFS) in the disputed area, trying to gather as much information as possible. Each one carried a single pistol, and diplomatic packets. They had orders to burn these if they thought they might get caught, doing something they shouldn't.
The Parthians
06-05-2005, 04:41
tag
Verghastinsel
06-05-2005, 12:15
Emil Dresner had taken government contracts before. Things that politicians didn't want to dirty their hands with, or wouldn't lawfully be allowed. Every successful government in history had employed men like him.
Emil lay in the dusty rubble of a disused warehouse, a bolt-action rifle in his hand. He'd stolen this antique from a museum last night, but it was dangerous as anything in the right (Or, in this case, wrong) hands. He lined up the iron sights and took a breath, held it for a moment, and exhaled slowly.
He pulled the trigger.
CRACK
The bullet struck the man in the side of the head, smashing through his skull, pulping his brain, and showering his kneeling companion with blood and bone fragments.
The guard was dead, now for the target. Emil took aim again, this time on the panicking demolitions expert. The man was firing his pistol into the dark, but remained illuminated by the light of the moon.
Emil shot again.
CRACK
The man crumpled, his lung pierced by the bullet. In his blood-soaked agony he could see his killer leave his hiding place, rifle in hand.
<"Puh...Please don't keh...kill me?">
Emil raised the rifle again. The man screamed his innocence.
CRACK
OOC: There you go. Emil walks away slightly richer, and now owns a K98 via the well-known principles of finders-keepers. He's wearing a trenchcoat, by the way. I didn't say that before and I meant to. Oh, and mum's dragging me down to Devon for a few days, so I won't be on so regularly. With luck I might be able to go to the library and use their machines once or twice.
The Infinite Crucible
06-05-2005, 15:05
The rain from the previous night had stopped, but this day was just as wet. One could drowned if they breathed too deeply, or at least it felt like one could. The humidity was suffocating and it felt at least 105 degrees in the sun. Dr. Violet, however was quite comfortable in his large office, which was of course, air conditioned. He was preparing two statements to sent off. One to the Generic Empire and another to the Buchiana rebels. At the moment he had no inclination to be loyal to each side permanently, but in this conflict he would aid the Buchianans.
He began to write a message in his typical long flowing handwriting. It was addressed to the Generic Empire.
To: Generic Empire/ Whom it may Concern
Subject: Buchiana rebellion
It has become apparent to our nation that you have been plagued by rebellion. Rebels such as these are disturbers of the peace and terrible godless men. We understand the need for military force, and are willing to send in an Inquisition squad and its support to aid in the destruction of these dissenters. I assume they should be deployed to Fort Lew, and will operate from there. I hope in the future our two nations can work together for the betterment of our people.
Sincerely,
Dr. Violet
Minister of Xeno Affairs
An aid came in and removed the sealed message from Dr. Violet’s care. Soon its contents had been scanned and were sent off to the Generic Empire. Only seconds after the first messages completion he began to write another, this one to the rebels. This one would have to be delivered by more covert means, which could be arranged.
To: Buchianan Freedom Fighters/ Whom it may concern
Subject: Freedom
The tyranny that this empire has held over you for many years can no longer be accepted. We are fully willing to send in two Inquisition teams to aid your force. One could train up and coming freedom fighters and the other could carry out raids on the disgusting military machine of the enemy. We have also sent an Inquisition team to the enemy, do not worry, they will be used for the gathering of intel for your forces. We do regret however that we can not send the two teams immediately as we must gain trust with your foe. When our double agent team is sent on missions we can coordinate the strike so it is a great illusion. Hopefully we can break the enemies iron grip on your land! Freedom for Buchiana!
With Greatest Hope,
Dr. Violet
Minister of Xeno Affairs
This message was also soon sent off. If all went well both sides would be in the dark and The Infinite Crucible would come out on top.
Shenyang
06-05-2005, 20:59
TO: GE
The Shenyang High Council, in accordance with foreign policy article 2, line 4, is willing to send the 1st through 5th ODST teams into Buchania in order to covertly undermine the rebels' operations. They are due back from another operation within three days, and can redeploy within another two. If you deem this to be suitable then we will send them, if not we are willing to look into the deployment of other forces, though this make take considerably more time.
We are aware that the ODST force of 40 is extremely minimal, however rest assured they are the best trained men that we can send, and will be able to hold their own with minimal support. We await your reply.
-Chairman Murdock
Doomingsland
06-05-2005, 21:29
Fort Antonius, Buchiana
For more than ten years, Doom Legionaries had operated within the barren hell hole known as Buchiana. The locals spoke of them in hushed tones in the back of pubs, and were rightfully afraid. The villages near the fort had been repeatedly swept for suspected BLA members, dragging men out of their beds in the dead of night. Once they got what they wanted out of them, the villagers would find the severed heads of the rebels mounted on pikes in the village square, their horribly mutilated bodies hanging upside down from a nearby tree.
Of course, about 25% of the people abducted weren't even members of the BLA, but they were killed either way. But in a less excruciating way, of course.
Fifty men manned the fort, which was little known, even to the locals. The fort was merely a staging ground for the dispatching of Hunter-Killer teams, who would go on operations to grab BLA members and assasinate enemy commanders. The base was of simple construction, surrounded by a mound of earth and a wooden palisade that was manned by all times, filled with tents and bunkers. At the center was a Forward Arming and Refueling Position (or FARP), which was used to maintain and operate the unit's only air support and transport: an MV-68 Banshee.
The base commander, a Colonel by the name of Gnaeus, had been in country since the Buchianan uprising. It had become a second home to him. He had had many years to learn the terrain and culture, and had quite a sweet little operation going: informants in the villages would give him the names of BLA members in return for a generous reward, one of his teams would go in and drag the guy out. An informant could also bring information regarding the location of rebel camps, but this was more uncommon.
OOC:More coming later, too lazy to do anything else.
The Island of Rose
06-05-2005, 21:47
The five men looked as the pictures flashed by one by one. The men nodded and did various head things that I do not know the words to, but they did those. No they didn't do that, pervert. They heard the Colonel speak, seeing the look on his eyes... those sexy eyes... oh, I'm going off topic. Here's a dollar keep quiet about it.
At the end of it all, Roy Johnson, the Major, cleared his throat and started to speak. "Let me address the issues you have presented to us. You are worried about the situation in the South, well let me assure you. We have an
entire fleet outside the waters of this province. We can order a missile strike into any of the cities in the South, but I'm sure you can too. I don't know the naval situation for you."
He continued. "Now on to your garrisson problem. You just send us in to where those garrissons are and we'll sweep those places up."
Staff Sergeant Anthony Cornoti was listening and interjected. "Yeah we'll help- oooh , a light bulb."
Meanwhile Staff Sergeant Jose Menendez was pondering things. "Hey Major, wouldn't it be funny if the Generian Colonel was having a drug overdose?" He snickered.
Colonel Johann Lancer thwaped Jose.
Staff Sergeant Robert Faw started to snicker.
Roy sighed. "Right... let me continue." He said. "Now as for the bounties. Wire the money up to the Defense Chancellory, they're the ones getting paid for this and giving us our paycheck. Oh and another thing, you have to take credit for every operation of ours. Not even the Imperial Congress knows we're here, so don't show any footage of us. You can do that right?"
Robert Faw mumbled to himself. "It's not like they're gonna know who we are..."
Colonel Johann Lancer thwaped Robert.
Roy rolled his eyes. "Yes. Anyway we get it, now if you could just direct us to our bunker. We're sleepy you know." He chuckled.
Rejected Nations
06-05-2005, 21:52
14 nautical miles of the coast of Buchiana
The Nasmith was currently still and was waiting for instruction from command. Either it would launch several helicopters, each able to hold 6 Rejected Nations special opperatives from the 2nd Marine Recon Unit, from its deck to aid the Imperial 40th or it would slip back into international waters and return to port. Officially the Nasmith wasn't there, it was off on some training exercise. Unofficially, it was there for support should the Generic Empire ask. All the Nasmith could do was wait.
Generic empire
06-05-2005, 22:01
-Securing Transmission
-Encrypting…
-Initiating Broad Transmission
Sender: Colonel Josef Jaroslav
Good day gentlemen. General Nriv’ka, and Mr. Slavochka send their regards. The first set of targets will be low level BLA operatives, primarily agents in charge of financing BLA operations and mounting small time sabotage operations. Nothing major, but definitely something we need taken care of before full scale operations begin.
These initial contracts shall serve to test both your skills and your loyalty to your Imperial contractors. If you prove yourselves capable, expect to be hearing about more difficult, and thus more lucrative contracts and operations.
Target 1
Name: Rourask Andropov
Known Activities: Racketeering
Information: Andropov’s been on the New Bucharest PD radar screen for years. He was known to operate several brothels and other business of less than respectable repute. We figured out a few years ago he was funneling some of his profits into BLA operations, and he’s been a full member since last year. He’s a notorious coward, and won’t put up much of a fight, though I wouldn’t be surprised if he had a few BLA heavies working with him. Intel reports he’s working out of a small whorehouse in a town just northwest of Fort Lew.
Reward: 5,000 Genera (G)
Target 2
Name: Burian Ivanovic
Known Activities: Extortion, small time muscle
Information: Ivanovic is little more than a common thug. Him and his men were used during the pre-secession years to bully the local populations into swearing loyalty to the BLA, and “donating” supplies and funds to the operatives. Expect him to have a working knowledge of firearms, and about a dozen armed guards. He’s reported to be hiding out just outside the village where Andropov’s lurking, probably directing the BLA units ordered to protect the finance man. A well co-ordinated attack could make this a double-snag.
Reward: 5,000G
Target 3
Name: Bohuslaw Ruriska
Known Activities: Embezzling
Information: Bohuslaw’s another of the BLA’s finance men, primarily responsible for hacking oversees accounts and transferring funds to the BLA’s (and his own personal) coffers. He’s not known to be a particularly loyal operative, and likes money more than the cause. Chances are the BLA will send their own thugs to take him out soon enough, considering him more of a liability than anything else. As much as possible, we want this one alive. His lack of loyalty and position means that he may have information on the whereabouts of the higher echelon BLA suppliers and monetary donors. He’s hiding out near an abandoned airstrip just south of the Northern Imperial Garrison, probably using the control antennas to tap into commercial satellites.
Reward 7,500G
Target 4
Name: Cestmir Andropov
Known Activities: Finance Advisor to midlevel BLA commanders
Information: The older of the Andropov brothers is currently overseeing a good deal of the BLA finance operations. He’ll be a little tougher to snag than the others, and will most likely have a good deal of BLA guards covering him. Still, he’s not one to want to face direct fire, and will most likely attempt escape under cover of his men. His base of operations is located in a town a few kilometers northeast of Fort Lew, in the basement of the “café Deska.” We expect that he knows the activities and whereabouts of several higher ups. As with the others, take him alive.
Reward: 10,000G
That’s all we’ve got for you at the moment. As you bring these guys in, you can expect more contracts to open up. Good luck, gentlemen.
-Col. Jaroslav
-trace elimination…
-end transmission-
((OOC: These opening missions will be largely capture and interrogation contracts, for the purpose of gathering intelligence, however, there will be several different types of contracts coming up, so if you're not into these, hang in there. Also, feel free to undertake your own operations, but clear it with Generian authorities if you're fighting for the Imperial government, just so that I stay in the loop, OOCly and ICly. Thanks.
Posts for BLA supporters coming up.))
Rejected Nations
06-05-2005, 22:21
-Securing Transmission
-Encrypting…
-Initiating Broad Transmission
Sender: Colonel Josef Jaroslav
Good day gentlemen. General Nriv’ka, and Mr. Slavochka send their regards. The first set of targets will be low level BLA operatives, primarily agents in charge of financing BLA operations and mounting small time sabotage operations. Nothing major, but definitely something we need taken care of before full scale operations begin.
These initial contracts shall serve to test both your skills and your loyalty to your Imperial contractors. If you prove yourselves capable, expect to be hearing about more difficult, and thus more lucrative contracts and operations.
Target 1
Name: Rourask Andropov
Known Activities: Racketeering
Information: Andropov’s been on the New Bucharest PD radar screen for years. He was known to operate several brothels and other business of less than respectable repute. We figured out a few years ago he was funneling some of his profits into BLA operations, and he’s been a full member since last year. He’s a notorious coward, and won’t put up much of a fight, though I wouldn’t be surprised if he had a few BLA heavies working with him. Intel reports he’s working out of a small whorehouse in a town just northwest of Fort Lew.
Reward: 5,000 Genera (G)
Target 2
Name: Burian Ivanovic
Known Activities: Extortion, small time muscle
Information: Ivanovic is little more than a common thug. Him and his men were used during the pre-secession years to bully the local populations into swearing loyalty to the BLA, and “donating” supplies and funds to the operatives. Expect him to have a working knowledge of firearms, and about a dozen armed guards. He’s reported to be hiding out just outside the village where Andropov’s lurking, probably directing the BLA units ordered to protect the finance man. A well co-ordinated attack could make this a double-snag.
Reward: 5,000G
Target 3
Name: Bohuslaw Ruriska
Known Activities: Embezzling
Information: Bohuslaw’s another of the BLA’s finance men, primarily responsible for hacking oversees accounts and transferring funds to the BLA’s (and his own personal) coffers. He’s not known to be a particularly loyal operative, and likes money more than the cause. Chances are the BLA will send their own thugs to take him out soon enough, considering him more of a liability than anything else. As much as possible, we want this one alive. His lack of loyalty and position means that he may have information on the whereabouts of the higher echelon BLA suppliers and monetary donors. He’s hiding out near an abandoned airstrip just south of the Northern Imperial Garrison, probably using the control antennas to tap into commercial satellites.
Reward 7,500G
Target 4
Name: Cestmir Andropov
Known Activities: Finance Advisor to midlevel BLA commanders
Information: The older of the Andropov brothers is currently overseeing a good deal of the BLA finance operations. He’ll be a little tougher to snag than the others, and will most likely have a good deal of BLA guards covering him. Still, he’s not one to want to face direct fire, and will most likely attempt escape under cover of his men. His base of operations is located in a town a few kilometers northeast of Fort Lew, in the basement of the “café Deska.” We expect that he knows the activities and whereabouts of several higher ups. As with the others, take him alive.
Reward: 10,000G
That’s all we’ve got for you at the moment. As you bring these guys in, you can expect more contracts to open up. Good luck, gentlemen.
-Col. Jaroslav
-trace elimination…
-end transmission-
((OOC: These opening missions will be largely capture and interrogation contracts, for the purpose of gathering intelligence, however, there will be several different types of contracts coming up, so if you're not into these, hang in there. Also, feel free to undertake your own operations, but clear it with Generian authorities if you're fighting for the Imperial government, just so that I stay in the loop, OOCly and ICly. Thanks.
Posts for BLA supporters coming up.))
14 nautical miles off the coast of Buchiana
The flight deck of the Nasmith was alive with activity. Three Blackhawk helicopters and one Comanche lifted off and sped to Buchiana. Inside of each of the Blackhawks there were six Marines from the 2nd Marine Recon Unit. Onboard the lead helicopter Night 1 was Captian Atticus J. Schofield. He had seen plenty of action and was a great commander. He looked at the other marines around him. They had all been briefed on what to do. They were going after a terrorist operative called Cestmir Andropov. Two helicopters would deploy troops opposite of each other to try and cut off any escape, while one would deploy troops directly via ropes onto cafe Deska. The Comanche would provide cover fire should anything get out of hand. Schofield looked at his watch. They should be arriving the target area in 15 min.
Roach-Busters
06-05-2005, 22:24
Generalissimo J.L. was taking a leisurely stroll through his gigantic backyard, taking whiffs of crisp, fresh morning air, and savoring the sweet, soothing, aromatic fragrance of spring flowers. The sun was shining, the air was warm but not unbearably hot, and the fields shimmered gold beneath the sun. The sky was baby blue and utterly cloudless. It promised to be a beautiful day.
Toting his shotgun, he whistled in a crass, off-key, but cheerful tone to some unknown song, wearing a jolly grin on his mustachioed face. It was that time again. Yep, another good ol' round of Shooban hunting, he thought pleasantly, wearing the expression of a man who was experiencing the world's most stimulating and satisfying foot massage. He flicked the safety off, shouldered the gun, peered into the scope, and was just about to pull the trigger, when all of a sudden he heard a voice shout, "Sir!"
Visibly annoyed, he cocked his head at the source of the disturbance, his butler Chives. "Goddamn it, in case you didn't notice, I'm busy here," he said, with ill-concealed disgust.
Chives bowed his head, an expression of shame and remorse on his face. "Mm, yes, yes, I see. I do, apologize sir, but I bring you urgent news."
J.L. guffawed. "More urgent than my daily round of Shooban hunting? Puh-lease. Don't make me laugh."
"It seems there is a secession crisis in the Generic empire."
The blood drained from J.L.'s face, his mouth agape, the strength waning from his body as his fingers loosened and the gun clattered to the ground. In an incredulous voice, he inquired, "Could you repeat, Chives?"
Chives did.
J.L. clenched his hand into a fist, which he swung in frustration. "Shit!"
"Sir?"
J.L. gritted his teeth, his breath coming in short bursts and ragged gasps.
"Sir?" Chives repeated, his voice freighted with benevolent concern.
"I heard you," J.L. said, his tone dull, morose. "Chives, please call the Ministry of Diploma-"
"No need, sir. It was Minister Moua himself who called," Chives said.
J.L. smiled wrly. "Well, that'll save time, won't it? In that case, please call the Ministries of War and the Navy."
"Yes, sir."
----
Four hours later...
To: Emperor Antonius I
From: Generalissimo J.L.
My dear friend, I am aware of this grave crisis, and I wish to help, as both an ally and a friend. I shall promptly deploy one National Guard division to quell this insurrection. Is this acceptable? If this is not enough- or, if it is too much- I can change the number of forces accordingly. In the meantime, Godspeed, and may your glorious empire triumph over evil.
Generic empire
06-05-2005, 22:31
((OOC: To clarify, send a message to the Imperial government, or whichever party is issuing the contract, before you go after the target. This makes claiming the targets a faster process, and prevents you from having to scramble to write a post before the target is claimed.))
Roach-Busters
06-05-2005, 22:32
(OOC: GE, could you make an OOC thread for this?)
Rejected Nations
06-05-2005, 22:33
((OOC: To clarify, send a message to the Imperial government, or whichever party is issuing the contract, before you go after the target. This makes claiming the targets a faster process, and prevents you from having to scramble to write a post before the target is claimed.))
Sorry. My bad. :)
Generic empire
06-05-2005, 22:39
(OOC: GE, could you make an OOC thread for this?)
((OOC: It's linked in post 1, but here: http://forums.jolt.co.uk/showthread.php?p=8827370#post8827370 ))
Generic empire
06-05-2005, 22:42
Official Imperial Communique
To: Generallissimo J.L.
From: Emperor Antonius I
My friend, I thank you for your offer of support, and most gratefully and humbly accept. You may deploy your forces as soon as you are ready, though I ask no more than 200 be deployed. They will find reception and shelter in the Northern Imperial Garrisons just south of New Bucharest, which will serve as their staging area. Good luck, and thank you.
Emperor Antonius I,
Sovereign Lord of Generia
Generic empire
06-05-2005, 22:54
The man, officially going by Darel Steat, began talking to those in the town in the Buchiana province. He made inquires into the nature of the BLA and where he could find members or those who could lead him to members, his accent marking him as a man not from the Generic Empire.
The bar was dimly lit, and full of the thick, sweet stench of cigar smoke. Several men at a table had been watching him, recognizing him quickly as one not from around these parts. Word spread quickly throughout the bar about what exactly his inquiries entailed. The largest man got up from the table, and walked slowly towards the man, who had taken a seat at the bar. He put a huge hand on the foreigner’s shoulder and bent down low, to speak into his ear.
“Come with me.”
He roughly, though discreetly pulled the man to his feet, and directed him towards a back room door. Once inside the small empty storage room, he thrust the man against the wall, searching him for weapons. He removed what the man was carrying, and pocketed it, before pushing him towards a second door. The large BLA man knocked three times, and the door swung inward. He pushed the foreigner inside, before a mahogany desk where a man sat shrouded in thick smoke.
He was well dressed, neatly groomed, and his carefully polished shoes rested on the desk in front of him. He removed the fat cigar from his mouth, and the smoke cleared somewhat, revealing a bearded face. A pair of dark sunglasses sat on the man’s prominent nose, a pair of .45 automatics sat in holsters that hung from his shoulders, over his dark green suspenders.
The man looked the foreigner up and down with disdain, before turning to the large BLA man, who had taken position beside him. He addressed his henchman in Generian.
“Boris, what the hell is this? Who is this guy?”
He looked back at the foreigner still standing in front of him. He spoke to him in broken English.
“Who are you? What you want?”
Generic empire
06-05-2005, 23:00
TO: GE
The Shenyang High Council, in accordance with foreign policy article 2, line 4, is willing to send the 1st through 5th ODST teams into Buchania in order to covertly undermine the rebels' operations. They are due back from another operation within three days, and can redeploy within another two. If you deem this to be suitable then we will send them, if not we are willing to look into the deployment of other forces, though this make take considerably more time.
We are aware that the ODST force of 40 is extremely minimal, however rest assured they are the best trained men that we can send, and will be able to hold their own with minimal support. We await your reply.
-Chairman Murdock
Official Imperial Communique
To: Chairman Murdock
From: Lord Varus Tiberius Alexei
Emperor Antonius is pleased that you have offered to support us, and accepts your support most humbly and with much gratitude. So long as your teams do not exceed the operational limit of 200 men, they will be permitted to operate with Imperial clearance within the Buchianan theater. They will find shelter and a permanent staging area at Fort Lew.
Roach-Busters
06-05-2005, 23:16
Official Imperial Communique
To: Generallissimo J.L.
From: Emperor Antonius I
My friend, I thank you for your offer of support, and most gratefully and humbly accept. You may deploy your forces as soon as you are ready, though I ask no more than 200 be deployed. They will find reception and shelter in the Northern Imperial Garrisons just south of New Bucharest, which will serve as their staging area. Good luck, and thank you.
Emperor Antonius I,
Sovereign Lord of Generia
(OOC: Sorry it took me so long to reply.)
IC:
To: Emperor Antonius I
From: Generalissimo J.L.
200? Are you sure that will be adequate? Very well, I shall deploy them promptly. If you are need of more, please do not hesitate to ask. The troops will arrive in the near future. They will fight for you as fervidly as if they were defending their own homeland.
Daikerta
06-05-2005, 23:30
(ooc: tag, will read and post when I have sufficient time, aka tonight.)
Shenyang
06-05-2005, 23:32
A C-130 Hercules of the SAF rumbled along silently through the night, onboard were the 40 men and women of the Shenyangi Operational Detatchment Shock Troops, or ODST. They each knew that once again they would be throwing themselves into hostile territory, against untold numbers, and they knew that as soon as they left the safety of the C-130, their life expectancies dropped like a angelfish in a shark tank.They moved toward the rear of the C-130, and checked their gear. Each one knew that their equipment was their life, if it failed they died. The small light on the wall turned green and the rear doors opened. Revenant looked back at the rest of the ODST and gave them a quick pep talk.
Revenant: Once again we are called upon to jump into unfriendly territory to protect one of our great nation's allies. We are the best of the best and we will not fail. Lets go!
With that Revenant turned and dove out of the C-130 the rest of the ODST followed. the ODST rocketed toward the ground far below. Over their radios they orchestrated their next move.
Revenant: Once we hit I want each team to move to your objectives. Each team leader has the secure channel to the SNS Valiance, once we get clearance from High Command we should be call in strikes from her. Remember that she's only got so many missiles so we can't use 'em too often.
Team Leaders: Affirmative, we won't fail sir.
Revenant: Damn straight you won't. See you on the other side guys. Alpha Squad form up.
The Alpha Squad created a circle along with Revenant, as did the rest of the teams along with their leaders.
The ODST fell toward the Earth, then opened their parafoils and landed silently in a small area. Then the teams began to move toward their objectives. From here on they only had each other to depend on.
Generic empire
06-05-2005, 23:35
To: Generic Empire/ Whom it may Concern
Subject: Buchiana rebellion
It has become apparent to our nation that you have been plagued by rebellion. Rebels such as these are disturbers of the peace and terrible godless men. We understand the need for military force, and are willing to send in an Inquisition squad and its support to aid in the destruction of these dissenters. I assume they should be deployed to Fort Lew, and will operate from there. I hope in the future our two nations can work together for the betterment of our people.
Sincerely,
Dr. Violet
Minister of Xeno Affairs
encrypting…
transmitting…
Official Imperial Communique
To: Dr. Violet
From: Lord Varus Tiberius Alexei
The Empire appreciates your offer of support, and will make ready to receive your teams at Fort Lew, where they shall be put in contact with the appropriate sources.
-end transmission-
To: Buchianan Freedom Fighters/ Whom it may concern
Subject: Freedom
The tyranny that this empire has held over you for many years can no longer be accepted. We are fully willing to send in two Inquisition teams to aid your force. One could train up and coming freedom fighters and the other could carry out raids on the disgusting military machine of the enemy. We have also sent an Inquisition team to the enemy, do not worry, they will be used for the gathering of intel for your forces. We do regret however that we can not send the two teams immediately as we must gain trust with your foe. When our double agent team is sent on missions we can coordinate the strike so it is a great illusion. Hopefully we can break the enemies iron grip on your land! Freedom for Buchiana!
With Greatest Hope,
Dr. Violet
Minister of Xeno Affairs
Sender: Nikolai
To: Dr. Violet
RE: Support
We welcome your offer of aid, brother, and are glad that you have heard our call. Let freedom ring in the ears of every Buchianan man, woman, and child, as the noise of battle and death ring in the ears of the Imperial war machine. We will arrange a meeting with your teams at a camp on the southern edge of the Eastern Buchianan Forests, where my commanders will bring you up to date. Again, we offer our thanks and praise your valor and nobility.
Death to tyranny! Long live Buchiana!
Dracun imperium
06-05-2005, 23:41
The Dominance soon was within vision of the shoreline, its might hull shining in the sun. Commander Varkin overlooked the sea of Buchiana, its violent waves as if an omen of what was to come. Then again Varkin was never into philosophy, his father had always told him was for sissies.
"Commander Varkin, within Helicopter range of Fort Lew." The captain announced. Varkin looked at the launch pad, and smiled, "Let's get this ball rolling ladies and gentlemen." The crew of The Dominance went into launching operations immediately. Helicopters were fueled, as were the planes and the troops boarded their helicopters.
The Apache Helicopter would fly as escorts while the transport helicopters landed at Fort Lew, the fighters would just be for show, hopefully. Commander Varkin boarded helicopter Alpha-03 and the air fleet took off.
Half Hour Later
Over Fort Lew, in the skies dozens of Phoenix designed F-3 HellCat IIs soared over the fort, as Apache Helicopters zoomed closer to the ground, as military grade transport helicopter landed at a designated landing field. Dracun Infiltration Troops (DIT) basic anti guerilla/guerilla warfare experts secured the area expertly trusting no one and nothing. "Area clear sir!" The Master Squad Leader announced and Varkin in all his military glory exited the helicopter, "Greeting members of the Generian Army, time to start the party."
The unmarked truck pulled up in the BLA camp. A man dressed in dark camo got out and walked to the head officers tent. He carried a brief case. There was something about the way he walked that made the various freedom fighters scramble to get out of his path. He walked with calm authority, and an air that he knew exactly where he was going. In this case that was to the tent of the general. Entering the tent he walked up before the general and dropped his suit case on the general’s desk. It opened, revealing thousands of neatly folded bills.
The general opened his mouth then closed it, he looked up at the man.
“Who sent you,” the general demanded.
“Letharn works for freedom everywhere,” the camo wearing man responded, “but if you don’t install democracy here, I’m authorized to inform you, that I will personally nail you to a cold metal pole to die horrendously over the course of a few days.”
The general laughed, the Letharn agent didn’t.
++++++
Ten minutes later the man was gone from the camp, leaving no trail behind.
The Island of Rose
06-05-2005, 23:58
A Rosian UH-60 Blackhawk (provided by the giant fleet outside the province) started to fly towards the wonderful whorehouse. It was an old building, very old. It was actually a dingy rusting warehouse of doom. It had two floors, and a basement. It was dark, full of disease, breaking down, standard dingy whorehouse stuff. It had a glass roof, the only source of light, and inside thei whorehouse of doom was a low level man of the BLA, who can supposedly give information to the GIIS. Which is a lie, I believe. But hey, money talks.
The UH-60 started hovering over the glass roof of the dingy warehouse. Why does it have a glass roof? Because it works into my story, so shh. Rappel lines came down and the five soldiers came down. The glass splattered all over the floor of the second floor and the five Rosktai came down.
Staff Sergeant Robert Faw and Staff Sergeant Jose Menendez were both armed with the RCAWS-7A. It was essentially a magazine operated shotgun, they would use these for breaking down the doors and the like. It was slender and it was semi, hell it was a nice shot too. Staff Sergeant Anthony Cornoti was armed with an RMW-7A. It was a marksman weapon, and it would be used to get anybody trying to escape or in specific the man they were going after. Major Roy Johnson and Colonel Johann Lancer was armed with the RAR-9K, the Kommandoe variant of the current assualt rifle. All of these guns, except the shotgun, used the 6.5mm Grendal. It was to be tested by the Rosktai before it went mainstream.
The second floor was merely a hallway with rooms to the side for the men to their, business. There were ten rooms on each side, and these ten rooms were set up nicely or was a wreck. Depending on how much money you paid. The squad started to bust into every room. The standard was simple, a man with an RCAWS would shotgun the door open, and the team would charge in. Most of the time they would scare the guy and the woman or there wouldn't be inside. They would arrest both with plastic handcuff things, with the guys crying and saying "Man, it's not usually this small! Don't arrest me! I'm scared of Bubba!"
After the rooms were cleared and the persons neutralized, they went down to the first floor, which was a lobby. It had a few benches and near the entrance to the second floor was a large counter thing where people stood behind to accept the money. All of a sudden five low level BLA men opened fire, with pistols and small sub machine guns. The five men ducked behind the counter, but handled it with finesse. Johann, being the resourceful man he was, threw a flashbang over the counter. As soon as it exploded the team charged in and proceeded to knock out the men with their weapons and arrest them. Now it was on to the target (Rourask Andropov) of this small operation. How fun.
The men started going down to the basement now, it wasn't that large. Just a small room with a hanging lightbulb and a small card table... with a small T.V... and VHS/DVD player... I'm done. The men charged in all SWAT style, three men were playing cards. Rourask Andropov and two other BLA men. They were going to reach for their guns, but they found out it was too late. They'd rather live. So they surrendered.
The men mumbled to themselves, who were these? They certainly didn't speak or look like Generians, but they were something. The UH-60 was already outside the entrance, so they loaded him up and let the UH-60 and let it fly away.
Now the problem is, how the hell would they leave. Now like a movie, all of a sudden the Chinook the Rosktai entered Fort Lew on put down rapel lines for them. They gladly accepted and so they got themselves inside the Chinook and started flying towards Fort Lew, wow. That was a crappy ending to this story eh? Ah well.
Roach-Busters
07-05-2005, 02:48
bump
(OOC: GE, can we just assume my men are already there?)
The Infinite Crucible
07-05-2005, 02:54
A large black unmarked transport helicopter landed on one of the outermost helipads of Fort Lew. It was dawn and the suns golden red fingers were just beginning to clear the horizon. This was an uncommon site to the men leaving the helicopter, there rarely were sunny days where they came from. Slowly large suitcases and combat bags were being loaded off of the helicopter. Moments later two far larger helicopters landed and unloaded two very different looking vehicles. One appeared to be a spruced up APC, that was painted all black and had extensive monitoring equipment, and the other was a beat up jeep. For how rugged it looked, it was quite solid and contained numerous state of the art systems.
Off of the first large transport helicopter exited eight grim men. It seemed as if the morning rays of the sun recoiled from their bodies, knowing they were forsaken to darkness. On the flight over they had been briefed with the contracts that had been put out by the Generic Empire. They immediately selected the one that posed the most risk of leaking information. They were to find and capture a man named Bohuslaw Ruriska, at least that was the official mission objective. They had received a heavily encrypted message from the resistance that their counter mission was to kill Bohuslaw or move him to a safe location. His death was a far more likely course of action. The team would have sent a message containing the other targets out, but it would have had a high chance of being intercepted when the crossed in Generic Empire airspace. They would meet a field agent of the rebels in the field and relay intel to him. This was their mission and it would be carried out with the grace of the god by the team.
The leader of the team was a man named Faedark Valentine. He had served the military for twenty years, and he was only twenty six. He was one of the elite few chosen at a very young age and school in the arts of war, more specifically subterfuge and special operations. It was said that he had over one hundred kills to his name, gained through true missions and training operations gone too far. A final two kills came from a test of loyalty. The murder of his parents.
Second in command was Dirk. No one knew anything about his past, save the fact he used to be a criminal. It was rumored that he had even served under the notorious criminal Jeffery Ottomon. The team valued his skill with a pistol though and his quick tongue. Maybe that’s what saved him from execution on his arrest.
Third in command was Cedric White. He was a veteran of Hells Circle, a closed boot camp which practices were considered too extreme. A boot camp going too far was unheard of. Either way he was one of the hundred survivors of the total of twenty thousand recruits that went into that place.
Below them were all men that had killed many times their weight. There was Tom Jolly, the demolitions expert. Mark Wallis a skilled sniper. Finally there were the Rolnick brothers. Rex, Dane, and Dylan. These men had all showed superior skills in stealth and combat situations throughout their military career.
This team was ready to do some damage.
"Who I am, that would be Darel Steat, or at least that's what my passport says. As what I want, that would be a bottle of scotch, a 72oz steak and a beautiful girl on each arm. Thought why I am here is the information you would be more interested in. I am here because members of my goverment have an intrest in seeing this province freed from the grasp of the Generic Empire." Darel replied to the man who was questioning him.
Rejected Nations
07-05-2005, 06:33
The two perimeter helicopters hovered over the target areas. Three ropes from each side of the Blackhawks dropped down and the Marines glided down them with professional ease. They all move to secure their positions so the attack on cafe Deska could begin. Meanwhile Night 1 hovered over the targe building. The Marines inside were waiting for the all clear. Then over the Marines headphones located in their helmets they heard the voice of Sgt. John H. Brooks.
"Perimeter secure."
With that the helicopter dropped it's ropes and waited as the Marines slid down them. Capt. Schofield was the first to hit the ceiling of cafe Deska. He mived immedietly to secure the roof, as did the other Marines. They spotted a door that led to the main floor of the building. They moved down the stairs and searched for a way to the basement. Schofield spied a door that led down a signaled his fellow Marines. They all lined up on the wall next to the door. Once they were ready, Schofield nodded and Sgt. Jason S. Wilks. Wilks nodded back and quickly opened the door. Before the enemy had a chance to react Schofield tossed in a flashbang grenade. He watied for the explosion before he ran in. After the satisfactory boom he ran in and immedietly turned to the right and stayed on the wall. Since they were blinded Schofield saw his chance and grabbed Cestmir. He pulled him out of the room, while the other Marines followed. They were covering the door and their exit. All of the sudden Schofield heard gun fire behind them. His saw one of his men throw a grenade into the room. Then there was a boom, and smoke came out of the basement. Schofield along with his fellow Marines, and their prisoner Cestmir, ran up to the waiting helicopter perched on the roof. They strapped themselves in and tied Cestmir up, just as the helicopter was taking off. It zoomed off to the Nasmith along with the other Blackhawks and the Comanche. Schofield looked at his Marines, then at their prisoner, and smiled. Another job well done.
At her desk in New Bucharest’s main government building the beautiful secretary sat organizing a report on her computer. The report was supposed to be to the Generic Empire, and indeed anyone looking at the screen would see the address to the empire. Not that they would be looking for anything, who would suspect the young beautiful secretary from the Generic country side of being a spy, furthermore as the office secretary of some of the more important, if low ranking officers, she was beyond suspicion. “It really made you think,” she thought to herself, “what a little back story and some Generic heritage reports could do for you.” With that thought she sent half a dozen pages of Generic troop movement to Letharn.
Kroblexskij
07-05-2005, 12:24
"Sir, we have new messages that arrived from the Generic Empire. Its concerning Rebels in The Buchiana province. sorry it didnt come through earlier we had problems with transmis......"
"Yes i know, i have known for days and havent been able to do anything
due to the damn comms system.
This should be nothing really, just a poxy group of unhappy people, about to be crushed by my taskforce.
Write this down, 8 mi-24
3 Mi-24 gunships
7 Mi-24 Transport
4 KA-29TB supply
2 KA-29CB transport
6 BMP-2s
- loaded on keiv class carrier.
6 mech squads = 48 men,
7 airborne squads = 56 men,
3 Naval ground Squads = 18 men,
18 logistical support
32 pilots/gunners
18 tank crew
---- from order of premier mikhalkov disembark 3 weeks , destination -Burchaina - province of Generic Empire
"all this rebel stuff reminds me of The Afgan war, remeber that?, oh well, we never found him and never will.
Take this to the docks and hangers."
he handed the paper to his secretary who promptly made a swift walk out of the room and down the corridor.
Shenyang
07-05-2005, 12:53
Revenant: Mission redirect, regroup at my position. we have orders to move to Fort Lew. Just made it to me from high command, so get your asses over here.
Luckilly the ODST hadn't travelled very far yet and they were all able to regroup within a few minutes. They began to move toward Fort Lew, several miles away. As they advanced they came upon a road, it was small and made of compacted dirt, The ODST could here a vehicle coming. They took cover behind a nearby hill. One, callsign Seraph,took position at the top of the hill, his silenced M-95S lined up on the vehicle when it came into sight. He followed the vehicle's path as it bounced down the road.
Seraph: Looks like an old jeep. Haven't seen them in combat duty for, oh, 'bout 6 years. Looks like its just the driver and a passenger, pretty well-armed, helmets, but the uniforms don't match, and they aren't really paying attention. I think these guys are rebels, permission to engage?
Revenant: Negative, just stay on 'em.
The jeep passed by the hill and continued without stopping, the ODST, once it was out of sight moved back toward the road, Revenant did a quick sweep of the area with the integrated thermal scope in his armor, and gave the okay for the teams to move, no snipers. The teams crossed the road and continued toward Fort Lew, now they thought they had a clear mental image of what they should expect, which wasn't much. They definitely knew they had the upper hand this time around.
Kroblexskij
07-05-2005, 12:55
At the Hangers
Now look here, many of you will remember the Afgan conflict, and this isnt too different, for those of you not acustomed to it,
This is a Helicopter War
we start on the deck of the Nogalstic kiev carrier here.
- the commander pointed to the map on his wall. His squad was a mix of veterans and novices, he wished to his non-existant god that he would be able to control them, they hadn't ever seen a war or bullets fired in anger. the dust of the ground as the heli lands and the smell of barren desert and oil burning on the Horizon, the cold and snow of the mountains and having to watch every corner. - His division had been picked because they were the Beaufort Watch, the North Mountain Troops of the Krob army. - He also knew that he would be in debt to the carrier and Navy when he got there, they would provide the intelligence and backup strikes against targets. - His mind the blanked back to the room.
Then we er, embark the Mi-24 HIND and follow the first wave of gunships travelling west between the North Imperial Garrison and the city of Dedovka. The LZ is in a hopefully empty space of farmland, for the first couple of days the only enemy armour you'll see will be the Tractors.
There were murmered laughs as he mentioned this. he knew it would happen and deliberatly made that joke to lighten the situation
We set up camp there and wait for the logistics to sort themselves out, you know how they are they usually forget or loose somthing. After that we make a hopping like movement towards enemy camps and troops taking out them before the Mechs arrive to clear them up.
We also might be employed to find specific targets or set up fireing positions on the mountains North of Buchiana, this will be played by ear.
we set out in 18 days aboard the Noglastic which will be moored 4 NM from Buchiana and will provide a launching base and limited backup fire on bunkers or armoured targets the Gunships can't penetrate.
Does anyone have any question about your mission?
There were a few uncomfortable grumblings but nothing more than normal, maybe the troops didn’t like their mission or wanted more action than to let the missiles do the work.
-- The commander dismissed his troops and returned to his Heli to contemplate his mission.--
Generic empire
07-05-2005, 15:09
OOC: Is this part two?
((OOC: Whoops. I forgot to post the link in part I. Sorry bout that, but yes, this is part 2.))
Roach-Busters
07-05-2005, 16:10
To: Emperor Antonius I
From: Generalissimo J.L.
The following forces are being deployed to Generia as we speak:
200 National Guardsmen
5 Dragoon Infantry Support Tanks
3 Roosevelt Heavy Main Battle Tanks
3 Taft Main Battle Tanks
7 SZ-5 'Snarl' Electronics Warfare Aircraft
Secret IC:
The Supreme Over Lord Chancellor of The Supreme OverLordian Empire of Zerbia sat on his throne, in his castle, in the capital of The Supreme Overlordian Empire, Zelgrade, watching the events unfold in the Generian province of Buchania, viewing the events unemotional, unsmiling, but with a certain cold and calculated familiarity, that led to one of the greatest Zerbian military operations in The Supreme OverLordian Empire's history.
It had been five years since the last time Zerbian soldiers had been on Buchanian soil, and The Supreme Over Lord Chancellor knew this well.
Five years since those events which had lead to the brief, but bloody Zerbia-Generia War, where the Empire of Generia had thrown it's forces at Zerbia, only to see huge losses that had forced a Generian withdrawl without capturing the Zerbian capital, Zelgrade.
Zerbia had grown since then. Recovered, prosperous. Stronger. In those years, the reputation of The Zerbian Armed Forces had remained undiminished, unrelenting in it's reputation for ruthlessness, efficient brutality that was not hindered by follies such as guilt, emotion or remorse that was usually connected to the normal human condition after combat, after killing.
Forever Pure. Forever Supreme in blood, mind and race. The Zerbian Race, above all others- The Supreme Zerbian Over Lord Chancellor stopped in his thoughts, as his long tapered fingers of his right hand rose slowly from his armrest that his right arm was resting upon, before they moved down to rest and were still once more.
Doomingsland, The Supreme Zerbian Over Lord Chancellor acknowledged.
The equals of the Zerbian race. A first, a chance encounter on the battlefield, almost a.... revelation, The emotionless man on the throne mused.
Zerbians on the Buchanina battlefield had engaged with Doomingland forces, and the battle that ensued that left nobody standing because of the equal strength and intelligence in mind and combat of the two sides, unseen before in either side's history, had gone down in history as a great awakening for both sides, and The Supreme Over Lord Chancellor had decreed that neither side should take up weapons against each other again, but recognise each other as equals of the race of purity on all levels.
Relations with Generia had improved, although Zerbian forays into the outside world had been limited, occupied with the decree by The Supreme Over Lord Chancellor that the Zerbians must crush it's border neighbours to expand purity and cleansing upon corrupted lands of subhuman hordes.
This decree was followed unquestioningly by the Zerbian Armed Forces, invading, occupying, and crushing the insignificant lands of Zent, Zophara, Zyckni, and Zrevim, creating the proclaimed 'The Supreme OverLordian Empire of Zerbia', actions and acts unoticed by the international world despite the horrifying brutality in the crushing of enemy soldiers, civillians, and merciless eradication of the children of the conquered lands, a policy called the 'Tommorow's soldier' policy, instigated by The Supreme Over Lord Chancellor upon the basis that all children of an enemy would grow to harbour vendettas because of the death of their parents and relatives and would pick up a weapon in years to come and continue a struggle.
It was a thought, threat, a lump, that had to be erased, crushed, eradicted, cleansed away, to make the tommorow secure, safe, sanitised, by eradicating the future threat today, so that the elimination of the future's threat was yesterday's work. Yesterday being today, tommorow being the future. There was no escape, only in death, and even in the extinction of life, death was not a release, for it was an instrument of the Zerbian Doctrine, and thus, not an independent agent. The death of a Zerbian was seen as acceptable, for the Zerbian would as Zerbian destiny would always pan out, simply be replaced by more Zerbians to be born, the continuation of Zerbian blood forever assured, and a Zerbian death was not something to be disgusted at, for the Zerbian death was inevitable in a world of assured Zerbian superiority as the supreme race of humans, who were not immortal in blood, but superior, and immortal in their assured superiority. But that was not to say a Zerbian viewed death as a priority, simply a factor. It was better to inflict death upon a enemy, for no enemy of Zerbia could possibly suffer a noble death, for it was an impossible trait for any subhuman of mind and body and blood and heritage to die a noble death, instead whimpering pathetically as they clung to it as the ways of a means of survival, not understanding the ways of a means to an end was a subhuman's life, that a subhuman lived simply before it died, that a subhuman served no purpose but to either be allowed to survive to observed as something that must be eradicated or something that was in the process of being eradicated because it was an abdomination, a fault in the world, an impurity, a figure of corruption and wrongness that had to be destroyed, not for the good of the subhuman, for a subhuman deserved no goodness, for it was something that opposed any sense of right, but because they were existing in a world of the Pure, the pure being the Zerbian Race, and to allow the subhuman to exist was an affront to the Zerbian race, for nothing inferior should be allowed to breathe the same oxygen as those of a superior race.
It was clear now, that the renegade Buchania province needed to be purified of the subhuman presence, a Zerbian operation that had been halted by differences in view on the matter with Generia.
"Priest For War" The Supreme Zerbian Over Lord Chancellor commanded in a authoritative tone to a man standing in the semi circle of men in front of him.
"Yes, my Supreme Over Lord Chancellor!" Said The Priest for War in a timid, but excitable manner, stepping forward from the semi-circle, head bowed.
The Supreme Over Lord Chancellor looked at him with complete disdain. "Communicate the following."
Official Supreme Zerbian Over Lord Chancellor of The Supreme OverLordian Empire of Zerbia Communique to Generia:
I hear you have problems that need to be eradicated, akin to five years previous.
These problems can be eradicated with ease, in the Zerbian way.
Let it be uninterrupted, in the style of The Zerbian Doctrine, and your problem will be erased.
Forever.
The Supreme Zerbian Over Lord Chancellor, of
The Supreme OverLordian Empire of Zerbia.
End of Secret IC.
Shenyang
07-05-2005, 22:32
The ODST were at the enterance to the fort. It was after dark and their faceplates glew with the thermal image being projected into them, the pale blue glow made them seem otherworldly, like some type of alien, or ghost. They stood waiting to be admitted.
Revenant: Yo! Anyone in there? We're the Shenyangi force sent to help you with this fine little mess! So let us in before we let ourselves in!
When finally the gates were opened and the ODST admitted they were more than a little irrate about having to stand out in the open for quite a long time. As a result they ignored all the hustle and bustle around them, and simply advanced methodically toward the command bunker. Most of the ODST stayed outside, training their weapons on random bystanders, the safeties were on, and for that matter the ODST had enough discipline not to shoot allies, unless they were betrayed. It merely served to frighten the other soldiers, so they'd make sure to stay clear of the ODST.
The squad leaders: Revenant, Seraph, Equinox, Bane, and Magistrate entered the command bunker, their weapons holstered, and walked to meet with the base commander.
Revenant: Hello, I'm Revenant, this is Seraph, Equinox, Bane, and Magistrate. We're the commanding officers of the ODST, we were dispatched to assist you in qwelling this rebellion. You might want to make sure none of the men already on site fire on mine, because odds are they won't last long if they do, and my men are probably trying to intimidate everyone else right now anyway. We don't want any fratricide here now do we?
Revenant took off his helmet and reached out to shake the base commander's hand.
Revenant: Oh, yeah, sorry about just busting into your command bunker, we're a little pissed about being forced to stand outside your gate waiting to get in here. So I apologize for that.
The Infinite Crucible
08-05-2005, 00:52
The Inquisition team’s aids and technicians were quickly moving the teams supplies to a small outlying bunker. The aids ranged from highly trained doctors, to radio men. Only one was really worth noting, a man name Ben Chester. Ben Chester was a torture expert, and was quite good at it, with forty years of experience. At the moment he was 52.
Dirk was sitting on a small moving crate slowly looking over his most prized pistol, it had been custom made for him before his capture. No one knew its specifications, besides him. He was slowly twisting it from side to side examining the dark metal when he heard footsteps in front of him and the whoosh of air that came from the raising of a rifle. He looked up and saw, what appeared to be a Special Forces soldier holding his rifle at him. His eyes quickly moved over the target sizing up, he realized he was a member of the ODST, whoever they were. Suddenly there was a great swelling in Dirks chest. It pushed up until he couldn’t contain it, he burst out laughing. He buckled over almost incapacitated with the humor of this event. After a few minutes he looked up to see that the soldier had left. He pulled himself to his feet, the same as before, but he had a cramp.
Inquisitor Valentine called his team together. “Alright, boys, we have a mission to do, but we still need to clear it with mission command,” he spoke. “Most have you have probably seen these ODST goofballs walking around, just ignore them, a good soldier, especially Special Forces know not to draw attention to themselves,” he continued. “That goes for you too Dirk, come with me to the command bunker,” he said with a chuckle.
With that the two men set off for the command bunker. Dirk exclaimed, “Can you believe those guys, trying to pull the tough guy act.”
“Look, don’t get yourself into trouble, but I agree with you,” he replied. “These guys look like a lot of flash, I don’t know how much flash does for you when you are a few feet from your enemy with your hand in his mouth,” he continued. “Its either, he bites your fingers off then shoots you in the gut, or you pull his lower jaw out and put one through the gaping wound,” he finished remembering a kill. “I wonder how many of them, have pulled the trigger that caused their fathers head to burst into a shower of mucus covered blood, and watched their mother bleed to death from the bullet wound you gave her,” he finished gravely.
“Damn pansies,” Dirk muttered.
After a few minutes the squad reached the command bunker and entered it. IT seemed that a few show offs were in their also greeting the commanding officer. Valentine merely frowned, but Dirk broke out into laughter again.
Shenyang
08-05-2005, 01:49
Revenant heard laughter from behind him, he pulled his hand back, and instinctively reached down for his SOCOM, he turned his head slowly, then turned his whole body to face the laughter. He saw the laughing Inquistitor, it took a supreme effort not to run up to him, elbow his face, and then as the inquistitor fell to the ground put a clip of SOCOM ammo into the bastard's stomach, then stand there and watch the idiot bleed for his disrespect. However Revenant managed to maintain his composure, he walked up to the laughing inquistitor, he simply smiled in his face then turned away.
Revenant: So you think you can laugh at the ODST, I bet you've got some grand reason you think you can just disregard us as show-offs or something, but I'll tell you now, that if you get in the way of me or my men, or if I see you make the mistake of laughing again then you'll end up lying in a pool of your own blood, watching twelve stomach wounds as they pump you dry. Do you know know what that feels like, have you ever been shot in the stomach? Have you watched you body try to melt through itself. Because I have, I wouldn't be here if I weren't the best. I know the best when I see them and I can tell you now that every single ODST out there would out last you with all your equipment using only a combat knife, you think your tough don't you, its people likle you that I've been killing for more than a two decades, so don't get in my way and don't mock my men.
By this time Revenant has turned around and is again facing the laughing inquisitor, in his eyes is a fire that inspires fear in most men, and awe in the rest, his face is set in an expression of sheer hatred of the inquisuitor, then he turns away and walks back to the other team leaders.
Revenant(thought): That dumb shit has no idea how close he just came to having his guts shreaded, he had better count his blessings because next time, his luck won't hold.
Kroblexskij
08-05-2005, 13:30
Somewhere about 5 NM from Buchiana Western Coastline --- 03:00
The Nogalstic cut the waves silently like an owl in the night as the Assault Helicopters rocked and the straps slackened and went taught in regular motions.
Everything was being checked for the last time, the men were cleaning boots and strapping up their battle harness' the helicopters were being loaded with primed missiles and gunpods then being moved up to Top Deck.
The soft pattering of rubber soles on the metal deck echoed around the empty ocean and the small hum of the standyby engines turned into a roar to wake the dead as the 3 Mi-24 gunships made their way towards the coast, followed in staggered formation by the 2 transport Ka-29CTs and then the other HINDS.
--- Yasha had just stepped onto the bay of the Supply HELIX when it took off, with a distgusting feeling in his stomach he nearly fell back into the safety net on the side of the carrier. His helmet wobbled and covered his eyes, he now knew that this wasnt going to be a good conflict. Fighting an invisible enemy with support from the local people, many opposed this action being taken and had asked for a more peaceful resolution, but a lot of nations had taken into the coalition to end the violence, and after all it was his job to thats why he was with the logistics.---
About an hour later they landed on Buchianain soil, the helicopter sank immediatly in the soft mud, he knew that his superiors had made at least one mistake, they had invaded a coastline during the after a night of rain, the farmland was wet and the wheels of the Helicopters had stuck in the mud.
---The Nogalstic had been radioed back after the first transporter sunk down, but no-one had told the Deck crews to stop sending troops.---
Men all around Yasha were leaping off the Helis, guns readied and then scrambling back on board without a care towards the mission. they would have to fly further north and then land on steady ground, that would take precious fuel that would have to be sent on later by extra Heli's. Now it would be a few more hours and pages of confirmation to find a new LZ and replan the tactics of the operation.
Shenyang
08-05-2005, 16:54
Revenant, having regained his composure looked to the base commander, he was back to his old, relatively stoic appearance, the fire being hidden by a supreme effort. He stood for a moment, then spoke.
Revenant: Well, now that I got that out of my system, any specific orders for us, or should we just do our own thing?
Borman Empire
08-05-2005, 17:37
Summary?
Generic empire
08-05-2005, 18:14
Through the rain spattered lens of a small electronic telescope, the man watched the Rosian UH-60 fly off towards Fort Lew. He reached inside his heavy brown coat and removed a cellphone, of the breed of devices issued as standard to all GIIS field personnel. The phone operated through Generian intelligence satellites, and transmissions were automatically subjected to voice scrambling and other encryption techniques, making interception a near impossible affair.
“They’ve got him. They’ll be bringing him in about a half hour.”
“The job?”
“Clean. Our inside man took a bullet in the vest, but he reports that they conducted themselves well.”
“Good. Get back to the garrisons for debriefing.”
“Will do.”
-encrypting…
-sweeping traces…
-line clear
-transmitting…
Official Imperial Communique
Sender: Colonel Jaroslav
To: Major Roy Johnson
Excellent work in your apprehension of Rourask Andropov. Very professional. Expect to be hearing from us again very soon. We’ll be wiring the bounty to Rosian accounts shortly. Congratulations.
-end transmission-
A man in a black overcoat stepped through the front door of the shattered café Deska. The air was full of smoke and the groans of wounded men. Slowly he walked forward, towards the slightly open door to the rear of the restaurant that read “employees only.” Still figures and broken glass littered the floor. The man paused beside one of the bodies, and rolled it over with his foot, revealing the bullet hole directly through the man’s right eye. He continued towards the door.
He placed his hand on the handle, and slowly pushed inward. The room was dark, the lightbulb having been blown out by a frag grenade explosion. There were several bodies lying strewn against the walls, and over a small card table in the back. From the corner of his eye, the man caught movement, and instinctively drew his pistol from the holster inside his coat. He whirled on the wounded BLA man, who was struggling to aim an AK-47 at the man’s head, and pulled the trigger. The figure slumped over, and the man holstered his pistol, retrieving in turn a small cellular phone.
“Everything looks good. There were…no survivors.”
The man looked back to the slumped figure of the BLA man he had recently dispatched.
“Alright. I’ll get in touch with the team leader. We’re sending a chopper to pick you up and take you back to GIIS. Be on it in 15.”
“Expect no less.”
The man replaced the cell phone, and strode out of the café.
-encrypting…
-sweeping traces…
-line clear
-transmitting…
Official Imperial Communique
Sender: Laszlo Slavochka
To: Captian Atticus J. Schofield
Good afternoon, Captain Schofield. Congratulations on your successful apprehension of Cestmir Andropov, the Imperial Generian Army’s Target 4. GIIS has been observing your conduct and finds it most favorable. If you are interested, we have another offer for you, something more suited to your level of finesse.
The BLA is using an alternate form of a dated GIIS encryption cipher to communicate. Their cryptographer’s have shifted some of the characters and changed others outright. It would take us months to break on ordinary circumstances, but given the nature of this war, we do not have months. Our field officers indicate a small observation post in the center of a village just a few miles south of the northern Imperial Garrisons that the BLA is using to send information on Imperial troop movements and relay them back to their commanders in the Lew Valley.
They are utilizing a primitive though effective communication apparatus to do so, consisting of a notebook computer connected to a communications dish. We want you to go in, grab the computer on which the encryption data will be stored, and destroy the dish. The village is a known BLA recruitment center, so resistance should be somewhat heavy, but nothing we are certain you cannot handle. We don’t care how you do it, just get it done. Reward for a successful completion will consist of 10,000 Genera and a future working relationship with GIIS.
-sweeping traces…
-line clear
-transmission terminated-
((OOC: As usual, more responses coming shortly.))
Rejected Nations
08-05-2005, 18:41
Official Imperial Communique
Sender: Laszlo Slavochka
To: Captian Atticus J. Schofield
Good afternoon, Captain Schofield. Congratulations on your successful apprehension of Cestmir Andropov, the Imperial Generian Army’s Target 4. GIIS has been observing your conduct and finds it most favorable. If you are interested, we have another offer for you, something more suited to your level of finesse.
The BLA is using an alternate form of a dated GIIS encryption cipher to communicate. Their cryptographer’s have shifted some of the characters and changed others outright. It would take us months to break on ordinary circumstances, but given the nature of this war, we do not have months. Our field officers indicate a small observation post in the center of a village just a few miles south of the northern Imperial Garrisons that the BLA is using to send information on Imperial troop movements and relay them back to their commanders in the Lew Valley.
They are utilizing a primitive though effective communication apparatus to do so, consisting of a notebook computer connected to a communications dish. We want you to go in, grab the computer on which the encryption data will be stored, and destroy the dish. The village is a known BLA recruitment center, so resistance should be somewhat heavy, but nothing we are certain you cannot handle. We don’t care how you do it, just get it done. Reward for a successful completion will consist of 10,000 Genera and a future working relationship with GIIS.
-sweeping traces…
-line clear
-transmission terminated-
((OOC: As usual, more responses coming shortly.))
Official Response from the Rejected Nations CENTCOM
Captain Schofield and his unit are at the disposal of the Generic Empire. They will gladly assist you in any way possible. Simply give the mission, with all need to know details, and they will be on their way to accomplish it.
Generic empire
08-05-2005, 19:12
-encrypting…
-transmitting…
Official Imperial Communique
Sender: Lord Varus Tiberius Alexei
To: The Supreme Zerbian Over Lord Chancellor, of The Supreme OverLordian Empire of Zerbia
I had wondered when we would hear from you again. It would seem that now we must call upon your services. It is time that we admitted our mistake in preventing you from dealing with the problem in the proper manner five years ago. My uncle allowed compassion for the Buchianans, whom he still saw as his people, get in the way of dealing with the situation. Now, we recognize your policies as necessary to put a final solution to this problem.
However, should you seek to involve yourselves in this conflict, there will be conditions placed upon your involvement. All operations undertaken that will require your particular brand of service will be subject to Imperial sanctioning and limited direction. For example, your men will not be turned loose to eradicate as they see fit. Instead they shall be directed to the problematic villages and garrisons, and given free reign only within those particular sectors, in order to preserve order and coordination among your operatives and Imperial forces in the area. Should you agree, you will find a staging area at a small Imperial military facility four miles southwest of Fort Lew, thus preserving the discretion of Zerbian involvement.
I never thought that I would utter these words, but, the Imperial government thanks you for your support.
-end transmission-
Shenyang
08-05-2005, 20:12
((OOC: Shenyang, you have to give me time to respond. I can't dedicate the necessary hours to this thread all at the same time. Please hang in there. I'm not forgetting to respond to you, I just don't have the time right now.))
OOC: Its part of the ODST's character, not me being impatient, I'll delete that post though.
The ODST outside the command bunker waited for Revenant and the leaders to come out, they were a bit imptient about having to wait in the open, with no one to kill, they had long ago stopped threatening the soldiers around them, seeing that it wasn't provoking very much of a response. They began walking around, getting aquainted with their surroundings, they walked in pairs, so that if one lost his temper with someone, the other could calm him down, or help him kill the offender. Meanwhile Revenant was talking with his team leaders as he waited for the base commander to get a chance to speak with them.
Revenant: I really should have just shot that guy, now next time I see him he's gonna get it worse than I woulda done now.
Bane: You kept it together well, I know that if I was in your position he'd be dead by now, thats why you're the commanding officer.
Revenant: Yeah, I thanks for letting me deal with him, I don't think he'll go laughing at us again without thinking twice, and if he does, remind me to kill him.
Seraph: No problem sir.
Revenant: Kind of odd don't you think, that this base is just sitting in the general area of the rebellion, but nobody's attacked since we arrived, like they're afraid. Well, they probably are, all these international spec. ops. showin' up would quiet me down if I was stil a rebel. We should wait a while, he's probably pretty busy dealing with the logistics for this peace-keeping operation. So just stay cool, and look disinterested. Good.
Kroblexskij
08-05-2005, 20:40
This is Commander Hulikaya Of the Krob Beaufort Division and Admiral Draskinki Of the FS Nogalstic
--- We are asking the Generic Empire to provide a Map of forces and troop positions concerning the western coast, south of the Imperial Garrison. Also asking for permission to use any nearby airstrips within range of 150 KM, Reason -- Bad information provided. Result conflict taskforce stuck in quagmire in western coast farmland. consisting of 18 helicopters and 6 APCs. Situation --VUNERABLE -- Fuel diminishing, have our own supplies, Battle plans changed, tactics with-held to Taskforce Commander's discretion. basic overview of BLA's capabilities are requested not nessarcery. If in doubt over anything radio frequency ---187.98 safe line--- will have translators on line to deal with problems.
Commander Hulikaya of the Beaufort Division and Admiral Draskinki of the FS Nogalstic.
OOC oh and any idea of scale on your map of buchiana
Generic empire
08-05-2005, 20:48
"Who I am, that would be Darel Steat, or at least that's what my passport says. As what I want, that would be a bottle of scotch, a 72oz steak and a beautiful girl on each arm. Thought why I am here is the information you would be more interested in. I am here because members of my goverment have an intrest in seeing this province freed from the grasp of the Generic Empire." Darel replied to the man who was questioning him.
“Hey, was I asking you? Boris, was I asking him? That’s right, of course not. Guy thinks he’s a smartass, doesn’t he.”
The BLA man stood up and leaned over the desk, jabbing a long finger at the foreigner.
“You want to be a smartass, I promise you won’t last more than ten minutes in Buchiana.”
He stood back up, and lowered his menacing finger.
“But if you want to keep your goddamn mouth shut and play ball, you came to the right guy. My name is Rostislav Mareki’ev. I’m running the show over here in Lew’s valley on behalf of Nikolai Mareki’ev, my brother. You listen to me, and do what I say, and maybe you come out the other end a very rich man. But if you fuck up, I’ll turn you over to Boris here.”
The large BLA guard grinned broadly, revealing the rows of gold teeth. Rostislav sat down again.
“Doesn’t look like you brought much muscle with you. S’alright, we can work with this. Listen, I’m going to give you something easy to begin. We’re pressed for manpower with most of our soldiers holed up in the valley preparing for the Imperial attack. We’re also pressed for information. Here’s the deal. There’s a GIIS station on the northern edge of the western farmland. They’ve been monitoring our communications and watching our deployments for the past few weeks, and it’s really starting to piss me off. You round up some of my men, and go pay those pigs a visit. If you can, snag me one of those cool miniature satellite receivers. I hear they can pick up ESPN. What the hell are you waiting for? Get lost!”
--------------
Fort Lew
As the helicopters touched down to unload their unhappy prisoners, Imperial soldiers rushed to take custody of the BLA captives, forcing them towards the entrance to the large bunker containing the detention centers and interrogation rooms. For the BLA captives, the last days of their lives would be their longest.
Colonel Jaroslav was interrupted by an aid entering his office.
“Sir, some Shenyang soldiers have arrived. They want in. I told them to be patient, but they’re-“
He was interrupted by a large, armored warrior waltzing into the office, shoving the aid out of the way. Surprised, the Colonel returned the man’s handshake.
“Er, welcome to Fort Lew. You’ve caught me a bit off guard, I’m afraid. I don’t have much of a presentation for you, so I hope you’re up on the situation. In brief, we’re still pulling up our main force, playing defense here along the entrance to the Lew Valley, where the BLA have holed themselves up, waiting to hit us or repel us if we try to hit first. I also trust you’ve seen the transmission with the authorized contracts, but I’m afraid the only open one is not suited to you particular skills.
I’ll tell you what. I just got a report from GIIS about some satellite photos showing a makeshift arsenal about ten miles from here. From the looks of it they’ve got everything from small arms to stingers. Maybe even some high tech gear we can’t see. It’s a small facility, but they’ve got a good couple dozen soldiers running around inside. If you boys can get in there and blow it up, I’d be most appreciative. We’ll talk payment later, but it should be somewhere in the ballpark of 7,500G.”
Generic empire
08-05-2005, 21:04
((OOC: I'm making the map of positions as we speak.))
The BLA scout peered through the scope of his sniper rifle, watching the struggling Kroblexskiji tak force from the loft of a barn a few hundred yards from where they floundered in the mud. He picked up his radio and urgently relayed the coordinates to his superiors. This could prove a surprisingly lucky break for the Buchianans early in the war.
-initiating broad transmission
Urgent Report:
To all supporters of BLA operations,
Our scouts have reported a large task force of unknown origin have landed on the coast along the edge of the western farmland. Transmissions intercepted indicate they are moving to reinforce the Imperial garrison at Fort Lew. This is a great opportunity for us, and we ask the support of any able forces in the area to move on the floundering assault force and destroy them. A significant monetary reward will be transferred to all involved parties.
Long live The Free Republic of Buchiana!
-end transmission-
BLA patrols in the area had been alerted to the status of the stranded assault force, and were now moving full speed to their position. With luck, the BLA could knock out a significant portion of the Kroblexskiji contingent early in the war. Maybe God was on their side after all.
encrypting...
transmitting...
Official Imperial Communique
Sender: General Nriv'ka
To: Commander Hulikaya of the Beaufort Division and Admiral Draskinki of the FS Nogalstic
We are transmitting the requested map and coordinates as we speak. There are two Imperial fortified airstrips nearby. The first is twenty kilometers north of your position, the other fifteen kilometers northwest. We are dispatching helicopter teams to provide cover and assistance to your forces immediately. We warn you that BLA presence in your area is reported to be very strong. Expect an ambush.
-end transmission-
Seth paced the operations room, and glared at his recent data. It outlined in no uncertain terms probable and certain allies of the Generic Empire. More then half of them had committed war crimes in the past, and would no doubt commit them in the future.
“This is intolerable,” Seth roared, “Doom Island, Rose, the Infinite Curcible, and Zerbia. How many of those nations have committed war crimes that we know about, and how many do we just suspect? No don’t answer that, I don’t care.” Seth sighed, “Shift our boys to phase two, preparation for active resistance, and double the aid we give the rebels. God knows they’ll need it.”
((OOC: sorry if I said anyone committed war crimes when they didn’t, Letharn information isn’t very good, and Seth is ver cynical))
Generic empire
08-05-2005, 21:14
((OOC: These are the known positions and base locations. Basically, this is general knowledge that is either issued to supporters of either side, or information that could easily be gathered through low level intel or scout reports:
http://usera.imagecave.com/mobrule132001/BuchianaTroopPositions.bmp.jpg
OOC: apologies, I am still very new to this I'll repost in a few hours when I figure out how to do this right. Sorry
The Infinite Crucible
08-05-2005, 23:04
OOC: I am just assuming my men talked to and were briefed by the commanding officer on site after the little laughing incident, just to keep things moving.
Valentine and Dirk had both returned to their temporary barracks across the base, and Valentine wasn’t too happy with Dirk’s actions.
“Damnit Dirk, the last thing we want to do is make enemies,” Valentine scolded. “I know these guys look like genuine assholes, and have not seen half the shit we have, but keep your cool,” he continued. “Don’t worry, we’ll kill em, but not now,” he finished with a whisper.
Most of the day passed quickly until about two hours before sunset they began to prep all their gear. Each men suited up in custom made spider silk combat armor. Each of them began to prep their weapons and about an hour after sunset they were rolling out of the base’s entrance. At the head was the beat up jeep and behind it the armored APC.
Valentine, Dirk, White, and Jolly were all in the jeep. Slowly the base disappeared in the distance and they entered a forest. The trees were burnt and many were dead. It seemed as if far larger amounts of troops had moved through the area. After about an hours drive the APC and the jeep split up. The APC stopped at the border of the forest and began broadcasting the arrival of the Inquisitors of the BLA in the area, guarantying them safe passage. Soon the jeep arrived at the airfield, and stopped outside the barbed fence. The four men disembarked and were greeted by two BLA operatives.
A BLA operative greeted them, “Alright, I guess you are the guys who are going to take out Ruriska, good.” He added, “There is some bad news though, the two guys guarding him aren’t BLA, he rightfully doesn’t trust us.”
Valentine assured him that this was hardly an issue, and entered the gate to the airstrip. The moon hung high in the sky give a great distance of vision to the men, but they used night vision anyway.
They approached Ruriska’s base of operations. It was a small radio hut that had many cords leading into a makeshift tower with a satellite on the top. There was a large spotlight over the entrance to the hut, and a heavily built man sat in a rusting lawn chair. He probably felt safe, everything within fifteen feet of him illuminated by the powerful light. Little did he know he had assured his death by blinding himself to the world outside of the ring of light.
The team of four men quickly and quietly moved up to the satellite tower, which was conveniently far from the light. Jolly began to lay small charges at the side of the tower. He knew the BLA wouldn’t be happy that their equipment would be destroyed, but it really didn’t matter to him. He just wanted to see something explode.
Jolly fell back and the four men hid behind a small stack of sand bags and barrels. Jolly proceeded to press a small red button. Suddenly there was a great rumble and a piercing ring in their ears, the charges had exploded. They looked up over the sandbags. The guard at the entrance to the hut was running full speed to the gate. White jumped up and went after him, knowing he would be important to capture. The remaining three men advanced to the door of the hut. With one swift action they kicked the door open. There stood a large man that had been reduced to a dribbling mess, urine could be smelled in the air. He instantly threw his hands up.
“Ruriska?” Dirk asked. The man shook his head and pointed to a blown out computer screen with a body in front of it. Dirk sighed and hit the man over the head with a pistol and watched him fall to the ground. They approached Ruriska’s body, the entire front of his face and upper chest was covered in small bits of glass. Apparently the explosion had caused his computer screen to shatter flinging hundreds of bits of death at him. Valentine noticed something, he was still alive. With tiny pathetic breaths he was holding on to life. Suddenly the dark sides to these men kicked in. Just as they began to reach towards his body, White opened the door with the other guard over his shoulder.
“Well that broke the mood,” Dirk said as he put his pistol to Ruriska’s head and pulled the trigger, “No fun tonight.” They grabbed the two men and handed them over to the BLA operatives still waiting at the gait to the airfield. The BLA wanted to know who would be running freelance muscle that interfered with their goals.
They began to head back towards base, a job well done. Why didn’t they come back with him some would ask. Well, they destroyed his equipment, and that had the nasty side effect of killing him. Completely true, but not the whole story.
Generic empire
09-05-2005, 00:07
The man watched the team through the infrared scope, safe on a crest overlooking the airstrip. Apparently they had not expected the GIIS handlers that had been monitoring each party of special-forces on these preliminary missions. The Island of Rose and Rejected Nations had benefited from this observation, however the forces of TIC would find a different reception. He grinned to himself beneath the black mask that hid his face. They would have a rude awakening when they returned to Fort Lew. It was bad policy to underestimate GIIS.
He removed the cell phone from his coat.
“Ruriska’s dead.”
“Was it an accident?”
“Of course not. It was a execution.”
“BLA?”
“No. Valentine’s men.”
“Alright. I’ll have a team waiting to take custody of them when they reach Fort Lew. Did they take the hard drive, or destroy it?”
“It’s intact.”
“Good. Go in and grab it. Be careful though, Ruriska’s men may be mercs, but they’re jumpy.”
“Will do.”
The GIIS handler replaced the phone, and slung the rifle over his shoulder, before cautiously making his way down towards the airstrip. Meanwhile, at Fort Lew an Imperial welcoming committee was assembling to meet the traitors.
Generic empire
09-05-2005, 00:09
OOC: apologies, I am still very new to this I'll repost in a few hours when I figure out how to do this right. Sorry
((OOC: No problem. I didn't realize you were so new at it, otherwise I wouldn't have been so harsh in my reprimand. Just be careful about claiming other people's responses, casualties, etc.))
Roach-Busters
09-05-2005, 00:21
A few miles outside New Bucharest
A squadron of black helicopters, their underbellies heavy with armament, emerged from a thick marshmallow-like mass of clouds, their propellers buffeting the air, destroying any remnant of silence that had existed previously as alerting everyone below to their presence. Within the massive choppers were the troops and vehicles the Generalissimo had promised he would send. The troops were among his most merciless, unforgiving, callous, and bloodthirsty. If asked, they would brain a toddler without so much as a blink or a flinch. They were 100% devoted to their leader, and would unhesitatingly obey any order he gave them. Even if he asked them to immerse themselves and their families in magma, they would do so. In addition to their loyalty, they were also great at interrogation. They could 'crack,' even the most stubborn people. Men utterly immune to pain and emotion were known to break down in tears, screaming, within minutes after being interrogated by these soldiers.
In other words, they were perfect for this mission.
The helicopters circled the landscape, landing a few minutes later. The doors were muscled open, and out stormed the troops, grim-faced, battle-hardened, armored from head to toe, clutching their guns and eager to wreak havoc, prepared to serve Emperor Antonius I as zealously as if he were the Generalissimo.
General Michael Ironfist, the commander of the squadron, radioed the Generian military to inquire the location of the enemy and what their orders were.
“A group if foreign forces marching in the open across Buchiana,” Seth grinned, “there may be a way to win this yet. Agent,” Seth said into a phone, “ you have a go.”
++++++
The route the Kroblexskiji forces were expected to take was lined with rubbing alcohol smuggled in under the cover of medical supplies. There were 27 agents each carrying 15 or so self made molotov cocktails, and 5 grenades. They each had also picked up an AK-47, never a hard find in a country torn by conflict. They had set the trap, now all they had to do was wait
(ooc: sorry about the earlier post, having read what god moding is I think I avoided it this time)
Roach-Busters
09-05-2005, 00:23
(OOC: GE, mind if I do an "interrogation" scene?)
Roach-Busters
09-05-2005, 00:44
As the soldiers awaited a reply from the Generians, General Ironfist ordered them to use some Shoobans they brought as target practice.
Generic empire
09-05-2005, 00:46
((OOC: Much better Letharn. RB, i've no problem with you interrogating someone. I'll let you have one of the captured BLA men, or if I capture some of TIC's men, you can try to break them.))
General Ironfist's radio crackled to life with a response.
"General Michael Ironfist, this is Colonel Josef Jaroslav, Generian Imperial Army. We've recieved word of your arrival, and request your presence at Fort Lew. We've got some new targets we need taken care of, and would prefer to brief you in person."
Roach-Busters
09-05-2005, 00:51
((OOC: Much better Letharn. RB, i've no problem with you interrogating someone. I'll let you have one of the captured BLA men, or if I capture some of TIC's men, you can try to break them.))
General Ironfist's radio crackled to life with a response.
"General Michael Ironfist, this is Colonel Josef Jaroslav, Generian Imperial Army. We've recieved word of your arrival, and request your presence at Fort Lew. We've got some new targets we need taken care of, and would prefer to brief you in person."
"Roger, Colonel. We'll be there in about half an hour. Over and out."
Shenyang
09-05-2005, 00:57
Revenant: Hmm, wonder what those morons are doing right now?
Seraph: Who?
Revenant: Mister Laughy and his sunshine squad, thats who.
Seraph: Oh. They have been gone a while.
The ODST then heard the base commander through the door, he was talking through the door about something, from it they barely made out the words:
"Ruriska's... Execution... Valentine's... take custody."
Revenant: Wasn't Valentine the name of one of the Sinshine Squad?
Equinox: Yeah, he was standing next to the laughing guy.
Revenant: Hmm, they must have done something, when the commander finally gets a chance to speak with us.
OOC: I hope I'm able to post, since I was involved in Part I of the conflict. Just tell me if I'm not and I'll retract this post. As in part I, I'm on the side of the BLA/ revolutionaries.
IC: Times were getting rough in Buchania. Since the start of organized conflicts, the fighting had increased dramatically. Not to mention the fact that bread lines were increasing, as businesses were finding it tough to attract business with the fighting going on. Only illegal arms smuggling was making any real profit.
Issaic had his shares of hard times, too. With the start of the conflicts, Novgovan intelligence had taken an interest to the fighting and had kicked Issaic out of his surveillence building/ residence. Bastards.
He had also seen the worst the war had to offer. A sniper in an apartment window missed a Generian soldier and had plunged into a mother and her toddler, killing them both. Fourteen, fifteen year old kids taking up the call of revolution finding themselves face down on the pavement, drowning in their own pools of blood after failing to kill a GIIS convoy. Women, some just children, finding themselves dragged into alleys, apartments, and barracks to be raped by Generian soldiers. That's why he took up the call to help the BLA long ago.
But things change, and the BLA was no exception. The BLA threw off its shadowy, undeground movement into a full-scale conventional army. The BLA, no longer small and no longer safe to trust, for now there were many infiltrators, had simply ignored Issaic. However, Issaic is not one to settle in the background to just fade away.
"Anyone home?" Issaic asked as he opened the door to his house.
Issaic indeed knew that his paramilitary squad, hand picked from the finest BLA men he could find, were waiting for him.
--------------------------------------------------------------------------
The group
Ivan:
Age: 18
Specialty: Bombs, mines, explosives
Nikola:
Age: 17
Specialty: Machine gunner
Jovan:
Age: 20
Specialty: Sniper, Driver
Franjo:
Age: 19
Specialty: Sniper
Andrej:
Age: 15
Specialty: Hacker
Svetlana:
Age: 19
Specialty: Intelligence gathering, infiltration, shooting with her AK
And finally:
Alexa:
Age: 35
Specialty: A Senior media officer for the BLA, politics
--------------------------------------------------------------------------
Issaic imagined his group to be Robin Hood and his merry men or the "Untouchables", although he knew that, excluding Alexa, most of them had scarsely made it passed puberty, and in the case of Andrej, was right in the middle of it. Fortunately, Andrej, being a hacker, tended to stay far away from any fire of any sorts.
"How's it going, chief?" Jovan asked.
Issaic walked into his house and had found his whole group sitting on the floor, polishing their guns.
"Damp outside today," Issaic replied.
"Did you hear? Nikola hit the big "5-0" today."
Issaic looked over to Nikola, who was etching tally marks into the butt of his PKM. "How many did you kill?"
Nikola briefly looked up. "Three today."
"That bring you up to 50 kills?" Issaic asked.
"52."
Issaic watched as Nikola etched his 52nd tally mark. "Kid, that energy's gonna burn you up."
"All the better to keep me warm at night."
Alexa, not usually the one to stay silent when she had something to say, interupted Issaic's conversation. "Did you here? They caught another one."
"Yeah I heard. It happened a few days ago."
"At least they haven't caught any of the bigwigs, yet," Alexa added. "Not that it matters, because they all have cyanide-potassium pills anyway just in case."
"Just hope they take them if the time comes," Issaic replied. "Dead men tell know tales and it would be a serious breach in security if they spilled their guts. They can get you if some one squeals."
"And you, too. After all, you've done some very nasty things yourself that I think the Generians would love to see you captured, tortured, and killed."
Issaic, indeed knew his record. In addition to being one of the largest sourses of intelligence for the BLA, betraying countless convoys and weak spots for the BLA to attack, he was an arms smuggler, he had organized the massive blackouts that paralyzed Buchania, incited riots, ambushed convoys himself, and embarrassed a GIIS squad transporting a friend of Issaic, and was partly responsible for the large crowd that incited the BLA into an open conflict.
"Bloody shame you're not on the hit lists the Generians listed," Alexa said sarcastically.
Yes bloody shame.
Roach-Busters
09-05-2005, 01:10
Fort Alexei, Generic empire
Fort Alexei was a massive, well-fortified military base that housed over 50,000 troops (OOC: But they won't be used in the RP, just the 200 like you said) and was surrounded by a ten foot thick moat over thirty feet deep and reinforced concrete walls impervious to all but the most powerful weapons. The few windows the fort had were tiny and armed with titanium bars carrying over 1,000 volts of electricity. An abundance of ill-tempered Dobermans, German shephards, and gun-toting guards ensured that no one could enter or exit this base unless that was the way its occupiers wanted it. Several SAMs also surrounded the base. Named in honor of the late, great Emperor Alexei, it was more reminiscent of a fortress than a military base.
Inside one of the "interrogation," rooms, reminiscent of a medieval dungeon, a captured BLA terrorist was being 'interviewed' by an RB interrogator known only as 'Mr. Smith.' Tall, gangling, pencil-necked, and wearing wire-frame spectacles, a green tweed jacket, navy slacks, old and battered shoes whose scrupulous polish could not disguise their age, and a gold Rolex watch. His blue eyes suggested an unassuming, modest nature. He had a thin, small, meticulously-clipped mustache, wavy graying hair, rather large lopsided ears, a distinctive acquiline nose, and a tight jaw. His lips were thin and hairless, his teeth small and sparkling white. He looked more like a university professor than an interrogator.
He paced the room slowly, with the air of a patient, cultured fellow, a wry smile on his face.
"So, you are with the BLA, sir?" he asked, his tone casual. He had a vaguely British-sounding accent and was in his mid-twenties. His bland features smiled.
The terrorist just stared, as if Mr. Smith were speaking another language.
Mr. Smith smiled. "Not very talkative, are we?"
Silence.
Mr. Smith shook his head, as if the terrorist were a student who had just brought home an unsatisfactory report card. "Strong silent type, eh?"
No answer. The terrorist could have passed off for a statue.
Mr. Smith snapped his fingers and his assistant, a hunchbacked, bug-eyed, profusely-salivating, bald-headed fellow less than four feet tall, named Igor, waddled away with the gait of a drunk penguin, returning a moment later with an extremely heavy brick-colored steel box containing Mr. Smith's "tools." In spite of Igor's size, he was remarkably strong.
"Thank you, Igor," Mr. Smith said, beaming.
Igor nodded. "Ayuh, 'snot a probl'm, Mastah." He lumbered away, cackling like a man fit for an insane asylum.
Mr. Smith opened the tool box, whistling "Campton Races," in an off-key tone that would have been amusing under different circumstances. He retrieved a ferociously sharp electric drill that could bore through diamond like a knife through melted butter. "Ready to cooperate, scum?" he asked, no longer using his cultured, gentlemanly tone. Now he sounded harsh, brusque, cynical. He activated the drill, rousing it from its dormancy with a shrill, metallic BZZZZZT! that caused the hairs on the back of the terrorist's neck to prickle.
Mr. Smith smiled sardonically. "Oh, yes, soon, you will be very cooperative," he said, and burst into laughter.
Generic empire
09-05-2005, 01:16
((OOC: Good to have you here Novgova. You're half the reason for this thread in the first place. Also, Shenyang, I replied on the previous page. Gave you a nice juicy assignment.))
Bettoria
09-05-2005, 01:26
.....................
...................
"Comms up and running sir"
"Thank you corporal"
Maximo considered his proposal
"Take this down Corporal and transmit immediately"
"Sir"
To whomever it may concern
The Generic Empire:
"The Holy Empire of Bettoria has for some time now monitored your internal conflict and opperation against the BLA. We understand this offer comes some time into the conflict, but we still wish to extend a hand of friendship to you and offer military assistance. Our proposal is as follows:
The Emperors own special operations unit of the elite Imperial chapter codename "Grim Reapers", comprising of 80 operatives (plus light support vehicles) will be deployed at your service to assist you in special opperations.
The Grim Reapers specialties include assasination, demolitions and hostage capture/rescue. We believe this specialist unit will be of great service to your cause and place them under your orders. Naturally all orders must be presented to and approved by our ministry of war.
In addition. In the event of further outside interference or escelation of this war the Holy Empire of Bettoria will place on high elert the 1st battalion of the Pope's division, codename "Crusaders". To be deployed for defence/scouting purposes.Again all orders must be reviewed by Bettoria's ministry of war.
If you do not require further military assistance then the Holy Hospital of Bettoria will land a contingent (size your choice) to provide medical aid on the battlefield.
We await your decision
May God guide you.
General S.B. Maximo.
The Holy Council for War.
.............................
"close comms"
"Aye Sir"
Maximo sat back and waited.
Generic empire
09-05-2005, 01:58
-encrypting...
-tap trace initiated...
-line clear
-initiating transmission
Official Imperial Communique
To: General S.B. Maximo, Bettoria
From: Lord Varus Tiberius Alexei
The Empire notes with gratitude your offer of assistance, and accepts. We are certain the skills of the Grim Reapers shall prove most useful in this particular theater, and will begin preparations immediately to recieve your division at Fort Lew. Again, we offer our humble gratitude for your offer of assistance.
Lord Varus Tiberius Alexei,
Chairman, Imperial Military Council,
Loyal Servant to Emperor Antonius I
-end transmission-
Roach-Busters
09-05-2005, 02:01
Forty-three minutes had passed, and General Ironfist and his 200 men finally arrived. "Sorry we're late," Ironfist said.
To: the Generian Goverment of the Generic Empire
From: Pres. Seth of Letharn, and the Letharn Congress
Sirs, the Letharn goverment has monitored the situation between you and the BLA, we have come to the conclusion that the area is no longer safe for the citizens of Letharn to inhabit. Therefore we would like permission to fly a small group of air craft, three chinook helicopters, and two hind class attack choppers, into your airspace over Buchania so that we may evacuate our citizens who are in that region. We are aware that your natural inclination would be to ask us to land in Fort Lew, however we are afraid that this is impossible, landing in Fort Lew, or indeed in any ware close by a Generian force. The reason being that if we were associated with the Generian forces our helicopters might be attacked as they leave. Furthermore we also would fear terrorist reprisal in our own nation. We ask you therefore to allow us to evacuate our people to safety.
Long Live the Empire
((OOC: this is a ploy to get more supplies and troops into Buchania))
Generic empire
09-05-2005, 02:21
Official Imperial Statement
Sender: General Vlakar Nriv'ka
To: President Seth of Letharn, and the Letharn Congress
I regret to inform you that unless you are willing to land at Fort Lew, there is nothing we can do for you. You must understand the need for caution in this situation, and we simply cannot permit your helicopters, military or civilian, into the Imperial no-fly zones. It is unfortunate that your citizens may be stranded in a warzone, however, ther was an Imperial travel advisory issued one week prior to the beginning of operations, plenty of time for evacuations to occur. If you wish to land at Fort Lew to collect your citizens, you may do so. If you do not, expect Imperial sorties to intercept your aircraft as enemy military combatants.
Wirraway
09-05-2005, 02:27
OFFICIAL CONCORDIAT COMMUNIQUE
TO: Empreror Antonius
From: Interim Coordinator Chester Brown
I am sorry to hear of the situation in Buchania, we lost many good men in their first doomed bid for independence. My predeccessor, Achilles, was always uncomfortable having that rebel province so close to our borders. I share the same sentiment, to have such discord and violence can only breed evil in our the periphery provinces.
We must stop this cancer, wipe it out before it gains a foothold. In this vein the 12th Army Corps is beginning to stage at the border, all we need now is your command to move in and crush them in a vice. Our forces from the South and the Imperial Army from the North.
May god smile on Generia and our purpose.
To: The Generic Empire
From: Pres Seth of Letharn and the Congress of Letharn
We understand completely. We ask however if you would be willing to house some civilians within Fort Lew where they will be well protected. While we are aware this may put them in danger in the case of a rebel assault, and may even cause problems in our nation if word that we asked you for help gets out (we believe there may be Buchanian nationalists in our lands), we still believe that if our citizens must remain in nation it would be best if they remained in Fort Lew.
((OOC: Seth is trying to get agents into the fort now))
Secret IC:
Location:The Supreme Castle Chambers, of The Castle of The Supreme Zerbian Over Lord Chancellor, Zelgrade, Capital of The Supreme OverLordian Empire of Zerbia.
The Supreme Zerbian Over Lord Chancellor, on his throne, read the communique from Lord Varus Tiberius Alexei with no emotion or feeling, his face a picture of eternal coldness, to any news, to any information.
Official Imperial Communique
Sender: Lord Varus Tiberius Alexei
To: The Supreme Zerbian Over Lord Chancellor, of The Supreme OverLordian Empire of Zerbia
I had wondered when we would hear from you again. It would seem that now we must call upon your services. It is time that we admitted our mistake in preventing you from dealing with the problem in the proper manner five years ago. My uncle allowed compassion for the Buchianans, whom he still saw as his people, get in the way of dealing with the situation. Now, we recognize your policies as necessary to put a final solution to this problem.
However, should you seek to involve yourselves in this conflict, there will be conditions placed upon your involvement. All operations undertaken that will require your particular brand of service will be subject to Imperial sanctioning and limited direction. For example, your men will not be turned loose to eradicate as they see fit. Instead they shall be directed to the problematic villages and garrisons, and given free reign only within those particular sectors, in order to preserve order and coordination among your operatives and Imperial forces in the area. Should you agree, you will find a staging area at a small Imperial military facility four miles southwest of Fort Lew, thus preserving the discretion of Zerbian involvement.
I never thought that I would utter these words, but, the Imperial government thanks you for your support.
-end transmission-
....
That is acceptable, The Supreme OverLord Chancellor thought, upon reviewing the message.
At last, they understand. The Tommorow's soldier Purification must be enacted to end resistance. To crush and eradicate it. To solve. To purify. To cleanse. Today, to avoid the tommorow being the next generation's turn to fight,he mused, his physical being, as ever, of no emotion.
But still, they are behind, behind in acceptance, behind in that they are reluctant to allow free reign of The Zerbian soldier, The Supreme OverLord Chancellor observed.
But to allow purification in 'problematic' villages and garrisons was a start,he acknowledged.
If only this had been done 5 years ago, to allow free Zerbian reign to enact The Tommorow's soldier, unhindered, or carry out the policy themselves, there would be no resistance today in the province of Buchania,the man on the throne thought with clarity.
Better late than never. Better earlier than later. The Supreme Zerbian OverLord Chancellor mused.
He almost smiled at that thought, but he remained impassive, no flicker of emotion on his face of coldness, as he commanded The Priest of War to communicate in reply.
To: Lord Varus Tiberius Alexei
From: The Supreme Zerbian OverLord Chancellor, of The Supreme OverLordian Empire of Zerbia
Your mission layout for the purification and Tommorow Soldier's Policy is acceptable.
I am sure you know that this policy should have been enacted five years ago, and that there would be no resistance in Buchiania if it had, but still, it is better to be later rather than never, the Tommorow that was then is now today and is plagued with the infestation of subhumanity that must be cleansed as a matter of priority for your Empire and a matter of course for The Zerbian race.
A new tomorrow now arises as the Tomorrow's Soldier Policy is enacted upon the subhuman filth who fester in Buchiania and who threaten your authority, one that shall be assured of being pure, uncorrupted, sanitised, eradicated of any subhuman element, crushed and wiped away to the point of no return.
I have ordered 200 fine Zerbian Soldiers of The Supreme OverLordian Empire Army of Zerbia that are upon a Carrier Purification Vessel of The Supreme OverLordian Empire Navy of Zerbia to disembark the Carrier, 10 men each, in 20 helicopters of The Supreme OverLordian Empire Air Force of Zerbia to be deployed at the small military facility four miles southwest of Fort Lew as agreed, where they will await further Directions in the areas of deliverance of purification assigned.
It is preferred that your preference in direction is communicated to myself so that I may deliver the direction myself, as The Supreme OverLordian Empire Armed Forces only obey a direct order outside their immediate ranks from myself or my representative, as an executive order that would be undertaken by them unquestioningly, their allegiance to me unquestioning.
May our two large and sprawling Empires prosper.
The Supreme Zerbian OverLord Chancellor, of The Supreme OverLordian Empire of Zerbia
Sending to receiver of communique over secured channel....
Acknowledged.
Encrypting as per Protocol.
....
......
......
......
Location.....
Skies over Buchianian Province of The Empire of Generia
Time.....
9:20pm
WHUMPWHUMPWHUMPWHUMPWHUMPWHUMPWHUMPWHUMP...
The 20 sleek, black helicopters of The Supreme OverLordian Empire Air Force of Zerbia carrying 10 Zerbian soldiers in each, flew stealthily over the dark and gloomy skies of the Buchianian Province of The Empire of Generia.
Noise emission from the rotar blades was reduced although still barely audible, a WHUMPWHUMPWHUMPWHUMP in the night sky. Only the most keenest of hearing Buchianian rebels would have heard it, the Generians meanwhile, were well aware who the helicopters were, and were obviously allowing it as per the arrangement in their request for a 'final solution' to the rebellion in Buchiania.
Commander Zaphyovich, in command of the 200 Zerbian soldiers assigned, viewed the fellow 9 Zerbian soldiers aboard the helicopter he rode in with pride, with knowing.
Fine Zerbian soldiers! Pure in blood, mind, and race! he thought proudly, observing the men sitting opposite him, and to his left and right.
All of the Zerbian soldiers wore body kevlar armour, dressed all in black, and all carried the very latest weaponry in technology, Zerbian Assault Rifles, Heavy Machine Guns or Sniper Rifles, flame throwers, Anti-Armour Kestrel Missile Launchers and the M203 Grenade Launcher, depending on the assigned role of the soldier in question. Their faces were hidden, by their trademark black Pith Helmet on their heads that came down over their ears, and to the Tri-Vision goggles that were over their eyes, for Night, Infra-Red and Heat-Seeking vision. Over their face, their mouths and noses were Oxy Masks, similar in appearance to gas masks, but designed to block debris in war time scenario from entering the nasal and oral cavities to allow breathing unhindered in combat.
They looked out of this world, a nightmarish vision.
They were, but they were a nightmarish reality.
Even though Zaphyovich could not see his soldier's eyes, he knew. He knew that underneath their masks and googles, their eyes were cold, unrelenting, merciless, unemotional, cold and hard, efficient and ready.
How a fine, brave Zerbian soldier should be, and is, Zapyovich observed knowingly, nodding his head at his soldiers, his, fine brave soldiers!
Zaphyovich, like his fellow Zerbian soldiers, knew of the exploits of their predecessor's operation of purification on Buchiania, and of ensuing conflict with the Generians because of their misunderstanding of the policy that led to a war between Zerbia and Generia.
Zaphyovich had addressed the troops aboard the carrier before they all boarded the helicopter.
"We all know of our history with the Generians." he had stated in an straightfoward cold manner, "But they understand now, our way. The right way, of combat and purification. The rebellion in Buchiania proves this. Indeed, we must not forget what has been, my fine brave Zerbian soldiers, but what is, was, what is now, is, and the Generians know now, as we did five years ago, that the province of Buchiania needed purification and The Tommorow's Soldier Policy...."
He had looked around at his soldiers before continuing in the same orderly calm tone,
"A fester boils in The Buchianian Province of Generia, one that has boiled for far too long with it's corrupted subhumanity and primitivity, a disgusting presence that must be eradicated, cleansed and crushed, to purify the lands and soil and waters. It will be done, for The Supreme OverLordian Empire! Of Zerbia! For The Supreme OverLord Chancellor!" Zaphyovich bellowed at the ceiling.
"FOR THE SUPREME OVERLORDIAN EMPIRE! OF ZERBIA! FOR THE SUPREME OVERLORD CHANCELLOR!" The 199 other Zerbian soldiers had chanted in unison in reply, a chant that swore oath to Zerbia, it's Empire, and The Supreme OverLord Chancellor.
Now, back in the present, Zaphyovich stood up as the helicopters all hovered over their insertion point of the small military facility four miles southwest of Fort Lew.
WHUMPWHUMPWHUMPWHUMPWHUMPWHUMPWHUMPWHUMP-
The rotar blades whirred as Ropes were tossed over the sides of the helicopters, and the 200 Zerbian soldiers disembarked into the cool dark night by sliding down the ropes of the 20 helicopters, a terrifying sight to behold, fully tooled up, landing swiftly on the ground into a circle of defensive combat positions, weaponry facing outwards as the helicopters above them, free of their load, immeadiatly drew up the ropes and flew away into the night, to return to the carrier.
Zaphyovich, like his fellow soldiers, looked at the enviroment around him, unemotional, calculating, through their NV goggles at the buildings surrounding them, before they almost in a single movement as one flicked their heads ever so slightly to the right, to activate the heat seeking vision with a VWROM! looking for tell tale body heat.
Already, they sought to purify the corrupted in body, mind and blood and existence.
End of Secret IC
Roach-Busters
09-05-2005, 15:54
(OOC: GE, my men are awaiting their orders.)
Rejected Nations
09-05-2005, 16:36
My men are also awaiting instructions.
Kroblexskij
09-05-2005, 17:49
At the Red Palace
"Its come through sir."
"What has, the parcel? god i can't stand our postal system, alway losing or stealing my things."
"No its the troops movements they...."
"Why haven't these been given to Admiral Draskinki fax them now, go go...!"
Aboard the Nogalstic
Here they are sir. As you asked.
---The seaman passed the Papers to the Admiral as he walked towards his phone.---
"Da , send this to the Mechanized and and air commanders, there in their rooms on deck 6."
---The seaman of the Krob Southern Expeditionary Fleet ran down to the commanders offices and gave copies of the maps to them.
After a while he recieved a briefcase marked with secret and a number of locks on it, and a handcuff on a chain. The guard outside the officers room promtly handcuffed the seaman to it and escorted him to the Admiral who personally unlocked it and put it in a safe deposit box.---
TOP SECRET----- FOR YOUR EYES ONLY
http://img93.echo.cx/img93/5535/buchianamap3iu.jpg
______________________________________________________
As the seaman left the room and returned to his duties the Admiral turned to one of his more trusted officers.
"Take this to the field and give copies to each squad or Pilot, they'll sort it out between them."
In the Field
"OK new plans coming through lets get our sorry asses out of here!"
All around the commander men jump back into their helicopters and the engines started up again.
"Follow Alkulya Squad HIND, you know, the one with the big red 04 on it. He has the lead plans and copies will be given out soon. We are going to a Generic Empire military base NEE of here and out of this goddamn mud."
A huge cheer set up among the troops.
"Although a suspected force of BLA troops is somewhere inbetween us and the base."
---the cheer died down at the mention of this.---
"And at latest reports the capabilities of them are high, we are not allowed to declassify them but, i can say they have the same weapons as some 1st world nations."
A dead silence set around the wet cold dank field.
"But come-on get yourself moving, do you want to sit here all day?!"
OOC i know i didnt do much to the map, but i will add more
Bettoria
09-05-2005, 18:56
...scanning......
...Target source locked.....
....ready to transmit.....
To: Lord Varus Tiberius Alexei
From: General S.B. Maximo
My lord, the Holy Emperor smiles upon you and sends his blessing.
I have Just this minute dispatched the Grim Reapers to your assigned staging area and await your proposed orders for this unit. Do not fear too much preperation of quaters for them as the Grim Reapers are used to a life in the field without any comforts and will only require minimal supply as a large part of their training teaches them to live off the land. My men will report to yor fort under the command of Lt. Colonel Gabriel and remain there until ordered to move out. From there they will remain in the feild and will be contacted via battlefield comms (all necissary contact codes are attached to this transmition) Colonel Gabriel is a cold man so do not expect many pleasantries and please do not mistake this for Bettorian ignorance.
We do have a request we wish to run by you.
The 1st Battalion "Crusaders" if required by you, will need to construct a Holy post for daily prayer. If this offends any nation present please inform us.
We await your orders.
God watches over us all
Good luck my friends.
General S.B. Maximo.
.....comms end..
" I just hope Gabriel doesnt stir up any trouble" thought Maximo
Later that day
the transports touched down with a loud THUMP!
Out strode Lt. Colonel Gabriel commander of the Grim Reapers. He took a second looked around declaring
"what a shithole"
"follow me lets get some rest and wait our orders"
The reapers nodded and silently followed their commander into the fort
Generic empire
09-05-2005, 20:58
My men are also awaiting instructions.
((OOC: Your mission was contained in that last communique GIIS sent you. Proceed when ready.))
Generic empire
09-05-2005, 21:42
-encrypting…
-tap trace initiated
-transmitting…
Official Imperial Communique
Sender: Emperor Antonius I
To: Interim Coordinator Chester Brown, The iron Concordiat of Wirraway
It is good to see you share your predecessor’s strong will and steady judgment. You speak the noble truth. This is a problem that must be dealt with utilizing all means necessary, and it is good to know we have your support. It is my decision, under the advisory of the Imperial Military Council, that all involved parties be limited to deployments of no more than 200 soldiers, thus leaving the primary campaign in the hands of the Imperial army. Your forces shall find a staging area at Fort Lew, where you shall be put in touch with the correct authorities.
Our thanks for your support, and godspeed in your campaign. May we prove the victors.
Emperor Antonius I,
Sovereign Lord of Generia
-end transmission-
------------------------------
-encrypting…
-tap trace initiated
-transmitting…
Official Imperial Communique
Sender: General Vlakar Nriv’ka
To: Pres Seth of Letharn and the Congress of Letharn
I find this to be an acceptable arrangement. If your citizens can make it to the gates of the Fort, they shall be granted entry, and secure quarters until they can be evacuated. However, all weapons will be confiscated and other personal belongings may be subject to similar procedure, as a security precaution of course. We do however demand that you provide an evacuation team within a period of two weeks. If this is not met, they will be transported out of the province to Imperial holding facilities elsewhere in the Empire until the war’s end.
-end transmission-
---------------------------------
-encrypting…
-tap trace initiated
-transmitting…
Official Imperial Communique
Sender: Colonel Josef Jaroslav
To: General S.B. Maximo
Good day. General Nriv’ka has been informed of the deployment of your forces, and will make preparations to receive them. Orders shall be issued shortly. We have no problem with the construction of a Holy Post, as Generia is a Christian society, though of largely Generian Orthodox persuasion. Whatever serves to make your soldiers better prepared and more effective for when they enter battle is a good thing for Generia and the campaign. Godspeed in your efforts.
-end transmission-
((OOC: I'll be getting the new contract list up soon enough, but there's still one target left. One of the newcomers should take it.))
Shenyang
09-05-2005, 22:40
Revenant: Excellent. I'll have my men on it in a few minutes.
Revenant turned and began to walk out of the office. He passed the aide on the way.
Revenant: Sorry about that. I'm a little displeased with some of the company here, I think you'll be okay though.
Revenant put his helmet on and nodded to the base commander before stepping out of the office.
Revenant: Time to go ladies.
Once he and the team leaders returned to the rest of the teams the ODST set out for the hidden arsenal. Along the way Revenant briefed them.
(excerpt)
Revenant has a map of the facility, procured from the Base Commander before he left. He is planning the assault with his teams.
Revenant: Now, once we arrive on site, I want Sigma team to take up an overwatch position on this hill here. You're to snipe any guards that present a safe target, if he has a friend, make sure you get both, and if we radio that we can't take this ourselves, be ready to call for support from the Valiance. Same for you Delta, but I want you on this hill here. Able and Bravo will enter the facility from the front here, and the rear here. Lastly Epsilon, I want you to cover the escape point, here, and be ready to assist Alpha or Bravo if need be. Got it?
ODST: Yes Sir!
Revenant: Good.
(End Excerpt)
Its twilight out when the ODST reach the edge of the designated mission area. All the better to disguise them and play tricks on the rebels' eyes. The teams split up, Alpha moved toward the main entrance, using the cover that was available to them, Sigma and Bravo went left to circle around the facility to reach their postions, Epsilon went right, as did Delta. After several tense minutes of moving into position, and radioing in to Revenant that they were in position, Revenant gave the go ahead to begin the operation. Alpha and Bravo crept toward the entrances, seeing the rather minimal security at the gates the ODST moved with a little more daring. Once they were close enough to take out the single guard in the guardhouses. Revenant took out his Mk. 23, Seraph, his AK-110, they levelled their weapons on the heads of the guards, and when they knew the shot was good, fired, the bullets shattered the windows, and the guards dropped silently. The ODST moved forward.
As Sigma's team leader, Magistrate, scanned across the facility with his SR-25, he stopped on a guard who seemed to be standing in the open with absolutely no one in the area, he levelled his rifle, took careful aim, and when the sight-picture was perfect, he pulled the trigger, between his breaths and between his heartbeats, with the skill of a world-class sniper. The guard dropped, after the side of his head caved in, and his brain spraying out the other side, along with the round.
Meanwhile Epsilon Demolitions Expert, Solemn, crawled up to the fence around the facility, on the west side, and placed a small C-4 charge, he set the remote detonator, and crawled back into the brush nearby.
Alpha Squad split into two fireteams of four, as does Bravo Sqaud. Each fireteam moved to secure one quarter of the arsenal for demolition. Revenant's team enterred the first building on their left. As Revenant enterred the small warehouse, he gave an order to the fireteams.
Revenant: All infiltration teams, go loud on my mark. (a few moments pass) Mark.
Each team now was cleared to use whatever weapons they had on them, which mean that they were going to be putting an awful lot of lead into the air. Revenant reached around to his back and brought up his personal favorite weapon, his heavilly modified M249 SWP, equipped with a 1.5x reflex sight, custom length barrel, Recoil surpression, and rebuilt entirely around the concept of being much lighter than a standard M249. This weapon had seem lots of action, and was heavilly scarred from years and years of abuse on the battlefield. He silently gestured to his team to prepare to breach the door into the office, he gave signals for his number two on this team, Gobi, to open the door, and for Caldera, the newest member of the team to throw a frag grenade into the room as soon as the door was opened. He would lead the team into the room afterword, and they would secure the room with a trip wire fused claymore once before moving on. Revenant gave the gesture for the breach to begin, meanwhile he heard heated gunfire from the other side of the base. One of Bravo's fireteams laying down a wall of lead no doubt.
The breach began. Gobi kick in the door, and Caldera threw in an M67.
Rebel: Shit! Grenade!
After the explosion Revenant and his team enterred the room, in a totally efficient, professional manner they enterred the room, it was pretty well shaken up by the frag, and two rebels lay dead, but none the less they still had to be sure. On the desk in the office Gobi found a rather official looking packet of documents. He took it and told Revenant, before puting into his uniform for safe keeping. As the team exitted the room Backfire, the fourth member set a claymore in the room, if anyone entered after this point, they'd make a nice a splatter on the wall, and that was about it. They moved on. At the next door they saw a sign reading "Main Storage Authorized Personnel Only" Revenant, knowing that a frag in this room could be a problem gave the order to simply breach the door, not throw a grenade first. Revenant openned the door and enterred, ahead was a guard, he fired a short burst, and the guard went down, behind him was a large vehicle, covered by a tarp, it was much too large to be a tank or APC, when Revenant look under the tarp he said two words.
Revenant: Damn, Scuds.
He gave the order to Gobi to climb onto the vehicle and set a C-4 charge under the missile, if that didn't work, somehow, Revenant set up a back-up charge in the cab, under the driver's seat. The team moved on. Outside the gunfire still raged, it was obvios that the rebels weren't too pleased. Revenant gave the order to exit the room to the outside and assist in the pitched firefight. Their team exitted out the side door and openned fire. The rebels, now in a state of full retreat were now trapped between two advancing fireteams, the command Alpha team, and the second Bravo team. They wiped out the rebels to the man, and continued, Revenant saw a fuel depot and gave the order to set a charge.
Meanwhile Delta's snipers were watching the firefight intently, watching for any turn against the ODST, they saw as one of the second team members was injured, grazed by a bullet, nothing serious. Then they saw it, a dozen rebels trying to flank the second team. They let loose with their SR-25s and M-95Ss. The rebels, caught off guard, turned and tryed to open fire, but the mercilessly precise fire from Delta Squad cut them down with ease.
Once the entire facility was rigged with explosives each fire team lead made a list of the weapons they had come across. The results looked fine alone. Revenant gave the order for Epsilon to blow the fence, and for all units to converge at the front gate. Alpha and Bravo squads backed out of the hole in the gate, and then ran to the gate thrugh the woods, all the teams arrived at about the same time, and as they moved away, using four jeeps that were parked close to the gate the soldiers who'd set C-4 charges detonated them. The facility errupted as the weapon's stockpile exploded. A large sinister cloud rose from the area where the facility had once stood.
Revenant took the weapons lists from the other fire team leaders. They were only lists of types of weapons, not specific numbers. He did not look very pleased. The lists spelled out a clear picture, that the rebels had a powerful, and well equipped backer, and that they were much better armed than expected.
The list:
Assault Rifles, assorted
Notable types: XM-8, M-4A1, OICW
Sidearms, assorted
Notable types: SOCOM, USP, Desert Eagle, Glock (various models)
Heavy Weapons: assorted
Notable types: FIM-92 Stinger, AT-4 Dragon, M2 .50, 82mm recoilless rifles
Vehicles: assorted
Notable types: SCUD launchers, jeeps, SA-8s, M-60A1s, Assorted APCs, BMPs, BRDM-2s, T-54s
Notes: These guys are mech better armed than we thought, perhaps analysis of the documents that were recovered may yield some clues to the origins of these weapons.
Once the ODST reached Fort Lew again they set up the temporary barracks, delivered during the operation by a Shenyangi MH-53J Pave Low. Revenant went to the command bunker and awaited a chance to be debriefed, he needed to hand over the list, and the documents, along with giving his personal assessment of the rebels equipment. The wounded ODST, Errant, went to the field hospital to be sure his wound was fine, and to get it bandaged, as the ODST field bandages wouldn't cut it if he had to make any extreme tacticla manuevers in the coming few days. After that he would be fine without a bandage, and would have a nice souvenier to show to his wife when he got home.
Rrrring!!!
Issaic looked at the clock. 5 A.M. As usual, he woke up early to prepare for the day. However, today was different. Today three major things were going to happen.
By time Issaic was able to get downstairs, Alexa and Jovan were already organizing stacks of anti-Generian pamphlets. After all guerilla warefare isn't just combat; its psychological warfare as well. Using a rented truck, they would distribute the pamphlets to BLA members throughout New Bucahrest who would then distribute them amongst the general public or on walls. Spray cans would also be distributed to write anti-Generian slogans and pro-BLA slogans on various billboards, as well as government property. (There's no better way to spread the word than on the Generians' very own APCs.)
Svetlana meanwhile, for whom gets quite a lot of looks from Generian soldiers, would sneak a bomb prepared by Ivan into the Generian-Buchanian Friendship Center, a ploy used by the local government to brainwash Buchanians into joining the cause and for the chance for Generian soldiers to meet some girls.
Alexa and Jovan got stuck in traffic because roads were blocked off because a supply convoy was making its way through the city. By time they reached all of their contacts, it was too bright and there were too many people outside to distribute the pamphlets and spray cans that day.
Svetlana had an easier time. She entered the Generian-Buchanian Friendship Center. Getting in was the easy part; the bomb and her made it easily into the building. However, getting out was the harder part. As there weren't many people that go inside the Generian-Buchanian Friendship Center, and even less that are as attractive as Svetlana, five to six soldiers were flirting with her as she tried to make it out. Since the bomb was on a timer, she tried to get out quickly.
"You will bring girlfriend, right?" asked one.
"Yeah sure," said Svetlana. "I'll be right back."
Svetlana raced out of the building and had made it down the block when all of a sudden the building exploded. Wooden splinters, bricks, and glass burst out of the building as the bomb ripped through the building.
The last soldier Svetlana talked to was thrown to the ground and blood was pouring from dozens of wounds all over his body.
"Doctor! Doctor!" he cried as ran to assist those less fortunate than him, those that were inside the building when the bomb went off.
Svetlana, rounded the corner to apparent safety from any pursuers. Judging by the amount of people she had seen inside the building that morning, she estimated that she killed about 8 soldiers, and wounded about twice as many as that. Svetlana took out her cell phone and found a secluded spot to call Franjo and Nikola.
"Mission successful. Your turn."
Franjo, perhaps the more calm of the group, was standing with Nikola opposite a movie theater, one frequented by many Generian troops. Franjo enjoying a good smoke, watched as the troops went in and out of the building.
"Okay. Understood." Nikola turned off his cell phone. "Time to go."
"Time to go already? Alright." Franjo threw his cigarette onto the sidewalk and ground the cigarette with his foot.
"You know what to do right?"
"Yeah," Franjo said calmly.
Nikola ran to the alley behind the movie theater and uncovered an AK he had hidden there earlier behind a dumpster. Meanwhile Franjo walked into the building right behind a soldier, carefully slipping anti-Generian writing into his pocket. That way, if the police came to investigate, they'd have a bigger reason to arrest the soldier than himself. Franjo walked into the theater, but quickly ran toward the restrooms while the ticketer was handing out movie tickets to the soldier.
Right before the restrooms lay his objective: a fire alarm.
"They tell people not to yell fire in a crowded movie theater," Franjo said to himself. "So I think I'll pull an alarm instead."
As soon as he pulled the fire alarm, he ran straight into the restrooms and escaped through a window.
The soldiers inside, more ticked off than surprised, more or less made it to the exits, although not enthusiastically. It was a good movie and they were sure it was a prankster.
However, the apparent calmness of the soldiers made it easier for Nikola. As some of the soldiers made it out of the theater through the fire exit, Nikola opened fire on them. Some ran back inside the movie theater, but Nikola chased after them, as he always recklessly did and shot at a few more.
When he made it back to the alley again he saw Franjo in a beat up Lada.
"Get in," he demanded.
Nikola ran into the car and the car sped off as fast as it could.
"Piece of cake," Nikola said to Issaic over the cell phone.
"Good, good. You guys have done well these past weeks. However, these are Second-Line infantry, just pushovers compared to the 40th," Issaic said.
"Yeah, well, we'll beat them up, too. It'll be easy!"
"We'll see about that. We'll see," Issaic said. He was confident that his group would rise to meet the challenge.
However, he knew the 40th wasn't no big deal. These were hardcore Generian fighters for the most part, and were some of the best the Generic Empire had to offer.
Generic empire
09-05-2005, 23:30
-tap trace initiated
-encrypting…
-initiating broad transmission
-transmitting…
Sender: Colonel Josef Jaroslav
Hello again gentlemen. Thanks to your efforts, we’ve managed to obtain two BLA operatives alive, and thanks to their cooperation with their interrogators, they’ve revealed the locations of several more notable figures in the area. As we speak, the last of the advance divisions of Imperial armor and infantry units are moving through the pass, and soon the Imperial army shall begin their push south, into the Lew Valley. Your job will be to clear the way for them. The operatives listed below are going to be tougher to nab than the first batch. Most are hardcore BLA lieutenants and commanders, in charge of military operations in the zone between the garrisons and the Lew Valley. These are the boys that are giving our scouts and convoys a headache, and we want you to move in and take them out. We will be providing air and artillery support for all contracts, as well as any necessary intelligence from GIIS.
Target 5
Name: Boris Greghov
Known Activites: Sabotage, Raiding Supply Convoys
Intel: This guy’s a dyed in the wool BLA hardman. He runs operations along the highways between the garrisons and the Lew valley, and has a good number of professional BLA scouts and saboteurs at his disposal in addition to the usual foot soldiers. We’ve been seeing a lot of his men probing around Fort Lew recently, and so chances are he, or someone higher, is planning something. Your objective is simple. He’s hiding out in a large camp a few miles west of the Lew highway running from the garrisons to Fort Lew. Capturing him won’t do anyone much good. He’s not one to sell out his friends. So get in there and put a bullet in his brain instead. This should cut off the BLA line of information somewhat. Good luck.
Reward: 12,000 Genera
Target 6
Name: Damek Krekov
Known Activities: Recruitment of BLA operatives, Management of BLA Finance Operations
Intel: This guy is a major pain in the ass. He’s been running BLA recruitment covertly for five years and has posts set up all over the northern countryside. The largest one of these is an old fuel refinery on the edge of the northern farmlands. He’s also the last major BLA financier in the area, and it’s expected that upwards of 4 billion dollars have passed through oversees accounts he manages. He’s bound to have information on account numbers and lists of the newest recruits and higher level commanders should be lying around his headquarters. We need him alive at all costs. However, if any of his underlings escape the refinery, the accounts he manages will most likely be closed. You must make sure no one gets out alive, no small task owing to the number of guards he has running around in there. You’ll need to be fast and hit hard. No screw ups. If you find any lists of recruits, snag them and call in an airstrike to blow up the refinery.
Reward: 15,000 Genera
Target 7
Name: Tibro Vrantasha
Known Activities: BLA Military Operations in the Garrison-Lew Strip
Intel: This is a big one. This is the man responsible for running security and heavy operations against Generian forces in the area. He’s the one directing the preparations for the Imperial assault across the strip. He’s got a lot at his disposal, high tech comms equipment, guns, and armored vehicles. He’s set up a base right smack dab between us and the Garrisons. Good news is, he’s probably too preoccupied with directing his forces to worry about anyone stealthily penetrating his flank. I strongly advise you not to take this guy on in a straight up fight. He will win. He has about 3,000 soldiers at his beck and call, and if you want to stay alive, you’ll sneak up on him. The stories about this guy are the stuff of legend. Some say he’s fought a full-grown bull to the death with his own hands. I recommend neutralizing him before taking him into custody.
Reward: 15,000 Genera
Target 8
Name: Rastislav Vletisha
Known Activities: BLA Forward Observation, Communications
Intel: Think of this guy as the BLA’s answer to GIIS in the area. He’s in charge of monitoring operations, communications, and troop movements, and reporting them to the higher gods. He’s using a small radio station in a village forty kilometers southwest of Fort Lew to broadcast his intel. From what we can see, he’s utilizing some pretty high tech stuff, only a few years out of date by GIIS standards, and that’s saying something. If you can take him alive, but he’s probably got a cyanide pill in his pocket, so you’ll have to be fast. Once you’ve got him, blow the station and take out the equipment, then get the hell out of there before the BLA reinforcements arrive.
Reward: 18,000 Genera
The Infinite Crucible
10-05-2005, 00:35
The members of team that had been left behind were sitting in their barracks looking over all the supplies multiple times to make sure everything was in order, and no damage had been done during the long trip over the homeland. Suddenly there was a knock at the door. Rex walked up and opened the door. A rather small aid was standing there, looking slightly nervous.
“Uh, Sir your presence along with the rest of the team is requested at the command bunker,” stammered the aid. He was obviously petrified, he was lying to a team of sadistic and highly skilled soldiers. While Dirk or Valentine would have sensed something Rex and the others merely thought that they had inspired terror in the local base population. This was a fact they took pride in.
The team began to cross the base escorted by the aid. Suddenly it happened, within an instant multiple hummers and soldiers emerged from the buildings around them. It was a perfectly executed maneuver. Having the best training in the world doesn’t help you much when you are surrounded, outnumbered fifty to one, with attack helicopters making passes, and all you have is your side arm. Wallis drew his weapon, but he was not fast enough. He was immediately hit with multiple stun rounds and the ground around them shook as several canisters of tear gas were shot at them. Within moments all four men had lost conscience.
The speed of the act was critical as one of them could have pressed a warning button notifying the rest of the team that they had been made. Wallis was actually trying to distract the soldiers from Rex who was making the move to warn the rest of the team. He finger was only an centimeter away from the button when he fell to the ground, knocked out.
The four Inquisitors from the successful mission were returning to base, oblivious to the danger that awaited them. After the same length journey they were coming to the base gates. Immediately Dirk and Valentine sensed something was up. There were new tread tracks coming from the bases entrance and no armored vehicles had been on orders to move out during the duration of their mission. Along with this the guards seemed jumpy, as if alarmed by their quick return. Finally their nose picked up a faint smell, gas of some sort. This didn’t look good.
The jeep slowed as it pulled up, and allowed the APC to enter the base first. Might as well let the techies be caught, not like they knew anything. Suddenly Dirk’s eyes noticed a group of men at ready just poking out from the barracks nearest to the entrance. They knew they had been made.
“You guys try and get out of here, I will keep the main guards busy,” Valentine said as he stepped from the jeep. “Good bye my friends, may we all feast with the Emperor,” were what he thought would be his last words to his team. His exit from the car through the guards off.
A random guard called out, “Why are you walking in on foot sir?”
Valentine replied, “Piss off soldier!” With that he dropped multiple smoke grenades and flash bangs and charged into the base. He let loose on full auto with his rifle, trying to attract as much attention to him as possible. It worked quite well. The guards were caught off guard by this and were slow to react. Partially because it was a shock, and partially from the flash bangs.
Then it began. Multiple canisters of tear gas exploded around Valentine, but he pressed on charging. He was hit with shock round after shock round, his heart bending under the stress. Every part of his body just told him to give in and fall to the grounds, but he pressed on. Then a round hit him right in the temple knocking him from his feet. He fell to the ground slowly losing consciousness.
While this was happening the jeep had begun to retreat from the base. As it drove off two large tanks moved to intercept it. The tank commanders hoped to frighten the jeep off the road, and had no true intention of destroying it. Dirk pressed on though. As the jeep passed between the two tanks Jolly threw two small grenades from the jeep. They both landed on the tanks hulls and blew up moments later, stunning the crew within but doing no true damage to the tanks themselves.
The chase was on. Two Generic Empire jeeps roared out of the base after the Inquisitor’s jeep. Machine gun fire exploded from the pursuing jeeps hitting the ground around the jeep but for the most part flying wide of the jeep. Cedric leaned out the back and began to fire off short controlled bursts at the pursuing jeeps. Despite his expert aim none of the shots hit their marks. Now it was Jolly’s turn. He threw multiple small bomblets from the back of the jeep which littered the ground. The first jeep saw them and slowed to avoid destruction. The second jeep, however, did not.
The small bomblets exploded rupturing the jeep’s gas tank and blowing out its tires. The men looked out mouths agar, not fully aware of what had just happened. An instant later the jeep was engulfed in an inferno. All the men were dead before their nervous system could relay the pain to their brain.
The first jeep sped up again flying past the smoke debris of the first. Cedric leaned out the back again and opened up fire again. At the same moment the trailing jeep began firing. Bullets filled the air. They flew past each other like swarms of angry wasps, colliding in an epic conflict. A few lucky survivors moved threw and hit their targets. A thick line of sixteen bullets riddled the windshield of the first jeep. It quickly lost control and careened into a ditch flipping multiple times. It two was engulfed in flames moments after the crash. Dirk cheered then looked back. Cedric had been hit in the chest. He was already dead.
“Damnit!” Dirk yelled as they turned on to a small road that led into a thick forest. He knew he couldn’t drive much longer. Air support would likely soon be looking for them. They stopped the jeep and Jolly planted a few charges within the jeep. With a few quick actions all files were erased from the on board computer and the hard-drive was ejected. It was then crushed under Dirk’s boot. They then headed into the forest. The charges were set to go off if the jeep was moved or tampered with in any way. If nothing set them off they would explode in eight hours.
The sun was starting to rise, but little could be seen through the thick trees. They moved without a trace leaving no mark of their passage. They were on their own now.
Doomingsland
10-05-2005, 00:52
Official Communique
We hereby claim Rastislav Vletisha as our target.
The Island of Rose
10-05-2005, 00:54
Official Communique
We hereby claim Rastislav Vletisha as our target.
Communique:
You don't mind we help you then.
Major Roy Johnson
(Doom! MSN!)
To: the Generic Empire
From: Pres Seth of Letharn, and the Congress of Letharn
We graciously accept your offer of shelter for our civilians. We will send an unarmed air vessel to collect them in about a week. Thank You again.
Shenyang
10-05-2005, 02:20
Once Revenant finally gained admittance to the Base Commander's office he entered politely, and saluted the base commander. He sat down and began his overview. Once he got to the list of weapons he handed it over. He saw a look of disbelief flash across the Commander's face, then it was gone, replaced by the look of a battle-hardened veteran. Revenant continued his account of the events. He concluded by handing over the documnets that had been taken from the office, they were bent slightly from the fact that they were on a soldier that had been in constant motion since their capture. After this Revenant heard a pip from his helmet, which he'd removed. He put it on.
Revenant: Yes, Revenant here. Yes General, I'll ask, I agree General, I'll call you back General. (to base commander) That was the Shenyang Military High Command. They would like to know if they could send a 6 ship squadron of our new, updated Cobra gunships. If they could run out of this base then that would be good, as you have all the facilitie that are needed to service them, and servicing them isn't different than the original Cobra, I assume your men still know how to keep those flying, right? If not then we can get a service crew here at the same time as the gunships. Sound good?
The Infinite Crucible
10-05-2005, 02:22
OOC: Nothing to do right now, so going to RP some more.
Dirk and Jolly had been pushing on through the dense forest for almost two hours. The thick wet underbrush lashed at their feet, making every attempt to trip them. An average man would have slowed, and possible even tripped. They, however, kept moving on at a great speed. Slowly the woods thinned and the trees grew thinner. The underbrush faded away and the mid day sun could be seen through the trees. About a hundred yards in front of them they noticed that the forest ended. They proceeded with caution.
Dirk approached the edge of the forest an pulled out a night vision scope. Damnit he thought. He wasn’t equipped for a night mission. He had to make due by using his eyes. He scanned the field in front of him. The large field had multiple craters in it, most likely caused by artillery barrages from the night before. The ground was smoldering and small fires slowly pushed through the field. Past the fields was a small blown out town. It looked as if it had been hit hard. He noticed movement in it, but wasn’t sure if it was BLA or Generic soldiers. Well, either way he had to press on.
The two men moved low and fast through the field, moving from crater to crater. When moving from the fifth crater to the sixth they came across a shattered body of a woman, her child was dead in her arms. Apparently she had been taking a night walk in the fields, her child probably cooing to her when the strike began. The faint whistle probably evoked a faint puzzle to her ears, then the shells hit. Dirk wondered what it was like for her in that instant she flew through the air engulfed in flames, knowing she and her child were going to die. This was no time for though and they made it to the final crater in front of the town.
Dirk peered over the top of the grain and looked at the numerous men moving throughout the village. They were BLA. While this was good news, he doubted BLA would actually trust him and would likely shoot him on site. He decided to take his chance. He and Jolly both stood up with their hands behind their heads, and slowly approached the village announcing their presence.
Multiple soldiers turned and raised their guns, barking out commands in a language Dirk didn’t know. Dirk laid down in the on the ground to show he had no aggressive intentions. Multiple men quickly came over and took them into custody, their fate was in the BLA’s hands now.
Wirraway
10-05-2005, 03:11
To: Emperor Antonius
From: Interim Coordinator Chester Brown
I respect your decision. A batallion of marines is en-route to Buchania along with a naval task force out of Falkhead.
--------------------------------------------------------------------------
It was not by chance that the 3rd Battalion of 1st Marine Division was currently loading up into its Bradley APCs under the watchful eye of Major Brown. Nor was it by chance that Hector Brown came to command this unit. In this case chance was succeeded by tradition, a tradition stretching back almost 200 years. Since the founding of the Concordiat the 3rd Battalion had been the personal command of the Brown family, every Coordinator of the hereditary dynasty had commanded the unit at some point or in a few special cases, merely served in it.
The 3rd was being sent to Buchania because, as for as long as anyone could remember, they were the unit detailed to the alliance with the Generic Empire. In fact the 3rd's motto read, Allegiance Guides Us . Whenever assistance was required by GE the 3rd Bat was the first in the fray. Hector was all to aware of this, having served under his father as a captain commanding an infantry company last time the 3rd shipped out to Buchania. After his father's tragic death in a firing range accident command had fallen to him.
A tough commander, Hector was battle hardened after years of experience in the Concordiat Army. Groomed for military service, rather than the post of Coordinator as was the case with his older brother Chester. The model soldier from day one he had the large build and noble stature of his ancestors, able to wield an XM-90 or a pen with equal force he was a tactician and warrior that few could tangle with. At this moment his dark eyes roved over the parade ground of his unit's home base in Vargus, dispassionately watching the loading process. Suddenly his roving eyes fixed on immobile APC
"I see Friedlander is having some trouble with that Bradley, whats up?"
"Transmission casing is shot to shit sir, those desert exercises over in Fort Haargyen played hell with our moving parts," replied his XO Captain Hicks.
The major replied instantly, almost yelling at his XO "Well switch it out then goddammit, I'm not sending our boys into that hell hole with faulty vehicles, you got that Hicks?"
The XO scurried off to rectify the problem while the major slouched against one of the massive stone columns holding up the reviewing portico that stood at the head of the massive parade ground.
A few hours later the Battalion was set up and ready to move out.
The Major walked slowly to his command track and entered from the rear ramp.
At his signal the 200 men and inside the 50 Vehicles of the 3rd began to rumble down the parade ground through the base, out of the main gate and onto Inter-Province (IP) 53 which lead up the border town of Vermound.
The 3rd was on the move again, bad news for the BLA.
As Warlord Shawhabas was in his office having breakfast, his secratery came bursting in.
"Sir, you have to see this, It happened yesterday!"
"Let's see it then..."
The Shawhabas sits and frowns as he watches the video tape.
"We must send aid immediately! mobilize the forces!"
"Yes sir"
I am willing to aid Generic Empire with-
-150 "Alpha Force" Special forces
-50 terrorists
-100 M-12 "Battlefortress" tanks
-2 AC-130D gunships
-50 Huey gunships
-12 Blackhawk helos
-65 Humvees w/50. cal
I know WMDs aren't allowed but is Tear gas OK?
Rejected Nations
10-05-2005, 04:57
Official Communique
Rejected Nations will be going after Tibro Vrantasha.
Bettoria
10-05-2005, 05:06
Gabriel stood in the centre of his quarters surrounded by his squad leaders and senior sergants.
"Brothers. The Generians have announced a new list of targets they wish to be "dealt with" (he gave a sly wink). Theres five targets so i think its time for the reapers to go to work (his officers banged the table in agreement). One of the targets has been taken so i propose we move fast in order to secure a target of our own.
My proposed target is Boris Greghov who runs all BLA opperations along the border. My proposal is based largely on the basis that Greghov is planning something around fort Lew or maybe something to the base itself. As you all know the 1st Battalion of the Crusaders is set to arrive anytime soon and i will NOT allow any action against this fort that places the lives of our Holy brothers in jepordy, shortly i will leave and announce our proposal to the Generians. Are there any objections? if so speak now my brothers.
The room stayed silent as it always did, the Reapers would follow Gabriel to the very gates of hell.
"Very well brothers, i will return soon"
Gabriel left and soon approached a Generian guard near the command bunker.
"you there"
the Generian snapped to attention
"Tell your superiors that Gabriel, commander of the Grim Reapers of the Holy Empire of Bettoria comes to claim Boris Greghov in the name of God and the Emperor. I will await their decision, intel and orders at my quaters"
"yes sir" the Generian replied and hurried away.
Gabriel turned on his heals and made back to his men. He smiled, looking down at his warblade.
"its been a long time old friend" he said stroking the hilt "but soon your wait will be over"
Generic empire
10-05-2005, 21:11
Smoke curled up over the heads of the two men, hanging heavily in the air, the sweet thick smell pervading the atmosphere.
“They’ve been busy this week, Nikolai. Their intelligence is good. Very good.”
“I expected no less. GIIS has proved itself before.”
“But taking Andropov alive?”
“Andropov was weak. He was a bookkeeper, not a soldier.”
“Then he will break in interrogation.”
“I guarantee you he already has.”
“Then what are we going to do?”
“Nothing. Let them think they have the advantage. It will serve us all the better when we hit back. Patience, Ziv. Patience is the key.”
“Nikolai, soon they will be moving their forces south, into the valley.”
“Of course they will, and there we will make them pay.”
BLA Training Camp, northern edge of the Lew Valley
The clatter of assault rifles, explosions, and shouting were thick in the air as the two officers watched from the crest of the low hill. Hardy recruits charged through an obstacle course in front of them, ferociously tore into mannequins clad in Imperial infantry uniforms, shouting patriotic slogans as they hurled grenades, and unloaded AK-47s at targets on the firing range.
Four weeks ago, the curriculum here at the secluded military encampment would have been slightly different. Among other things, heavy focus would have been put on sabotage, bomb making, and assassination. However, times had changed, and so had the Buchianan strategy. The BLA commanders recognized that Buchiana would not be won through subterfuge and ambush alone. If there was to be a true, clear victory, they would need an army.
The first of the officers was a tall man, dressed in a finely pressed, new uniform tailored specially for him by a patriot in Deskograd. On his arm was the newly designed insignia of the Army of Buchiana. The man was General Vasilly Bjeylic, a former Generian army Colonel, and a Buchianan native who had been selected by the BLA to be put in charge of creating and later commanding the Buchianan Army.
“How do they look?”
“Like shit. These men are peasants.”
“Peasants are all we have, Vasilly.”
“I need soldiers, Nikolai, not farmers.”
“That’s why you’re here. To make these men soldiers. They are patriots, volunteers who want to die for Buchiana.”
“If we intend to win, they’re going to have to kill for Buchiana, not just die for it.”
The General grumbled, and walked off down the hill.
“Can he manage it?”
“If anyone can turn this rabble into an army, it is this man.”
“I hope you’re right.”
“I’m always right.”
-------------------------------------
-encrypting…
-tap trace initiated
-transmitting…
Sender: Rostislav Mareki’ev
Good day patriots, friends of democracy and a free Buchiana. The BLA has been observing your progress in country, and is under the opinion that you are trustworthy and favorable advocates of our activities. We are aware that many of your organizations, or nations as it may, have dispatched teams to the nation to aid us in our struggle in a more direct fashion than simple behind the scenes backing. Throughout your operations here, I will be serving as your contact in country, on behalf of Nikolai. If there is anything we know, I will make sure that you are just as informed, and if there is anything we need done, I will make sure the task is opened to you, for a healthy reward.
As I am certain you will have guessed, the Imperial army is preparing to make a direct push into southern Buchiana, a move that we are certain they will regret. As it is, we have managed to obtain a good deal of information on their preliminary activities in the region. As you know, the Imperial Intelligence Agency, GIIS, has taken a direct interest in this matter, under the direction of a man whose name we do not know. GIIS is very careful with their information control. It will be a large part of our task here in these early portions of our struggle to undermine this institution of tyranny. Therefore, I open the following contracts to you.
Contract 1
Intelligence: Our scouts have indicated that GIIS has recently set up a small forward listening post in a small farmhouse just north of the western farmland with which to monitor our activities in the area. We believe that the intelligence gathered from this station is largely behind the recent strikes on our operatives in the Lew stretch. We need to teach those bastards to mind their own business. We need someone to go in and clean the place out. There are bound to be a half dozen GIIS men inside, and I want them all dead, but be careful. I hear these guys are lions when cornered. When you finish, destroy the station and any intelligence they might have collected. They probably also have some good gadgets lying around in there. Try to snag one of those listening devices while you’re inside.
Objective 1: Neutralize GIIS supported listening station
Objective 2: Steal a GIIS long-range electronic ear
Reward: 5,000 Genera
Contract 2
Intelligence: GIIS has begun their own propaganda war against us in the towns, apparently hoping to dissuade the patriots from taking up arms against their overlords. We have learned of a small printing facility where they’re manufacturing pamphlets for the Imperial army to distribute in the local villages. Taking it out could greatly set back their information war, and give us the edge we need. It should be mostly local civilians and only a few guards. Not terribly difficult. The civilians have no doubt been corrupted by the propaganda far beyond salvation, something we can’t allow to continue. You’ll need to purge the slaves to the system, but make sure none of them escape. Blow up the press, and get out quietly.
Objective: Destroy GIIS Propaganda Press
Reward: 7,500 Genera
Contract 3
Intelligence: There’s a small town a few miles south of the Garrisons where our operatives have received reports of a GIIS station located in an apartment building. We thin that someone important is running the station up there. He might know something about GIIS operations in the region. We don’t know who he is, but we know we want him. Get in, grab him, and get out before they miss him. We’ll have a truck waiting in the forest for you just outside the town.
Objective: Capture GIIS agent
Reward: 10,000 Genera
This is all we have for you at the moment. Expect more following your completion of these objectives. Also, do not forget that our reward for the ambush of the Krob convoy still stands.
-end transmission-
Doomingsland
10-05-2005, 22:13
Fort Antonius
The drums began to beat, signaling for the men not on guard duty to assemble in the center of the camp. The men, wary of a possible mission, were already ready. Equiped with VEPR NGCS and M28 SOPMOD rifles, the Legionaries thirsted for the blood of their hated foe.
The men quickly got in formation in front of a slightly raised platform of wood upon which stood their colonel. He was clothed in simple fatigues, a cigar hanging out of the corner of his mouth. He stared at the darkly clad men assembled before him, their faces concealed behind armor gas masks, and spoke,
"Alright, men I suppose I may as well make this quick. Intel puts a BLA higher-up fourty klicks southwest of Lew in a village. He's got some fancy-ass com gear the Imps want us to blowup, and they want him to bring him in alive." he said with a smile. His expression then became grim. "Torch the village. Leave no witnesses. STRENGTH AND HONOR!" he yelled.
"STRENGTH AND HONOR!" they replied in one voice, pounding their chests in salute.
And off marched the selected eight men, boarding the waiting MV-68 for the trip down to the village. However, the colonel had neglected to mention they'd be working with foreign soldiers on this op...
And so the set the stage for the what was to be the first of many massacres in this war...
Generic empire
10-05-2005, 22:16
Official Communique
Rejected Nations will be going after Tibro Vrantasha.
Remember this?
Originally Posted by Generic empire
Official Imperial Communique
Sender: Laszlo Slavochka
To: Captian Atticus J. Schofield
Good afternoon, Captain Schofield. Congratulations on your successful apprehension of Cestmir Andropov, the Imperial Generian Army’s Target 4. GIIS has been observing your conduct and finds it most favorable. If you are interested, we have another offer for you, something more suited to your level of finesse.
The BLA is using an alternate form of a dated GIIS encryption cipher to communicate. Their cryptographer’s have shifted some of the characters and changed others outright. It would take us months to break on ordinary circumstances, but given the nature of this war, we do not have months. Our field officers indicate a small observation post in the center of a village just a few miles south of the northern Imperial Garrisons that the BLA is using to send information on Imperial troop movements and relay them back to their commanders in the Lew Valley.
They are utilizing a primitive though effective communication apparatus to do so, consisting of a notebook computer connected to a communications dish. We want you to go in, grab the computer on which the encryption data will be stored, and destroy the dish. The village is a known BLA recruitment center, so resistance should be somewhat heavy, but nothing we are certain you cannot handle. We don’t care how you do it, just get it done. Reward for a successful completion will consist of 10,000 Genera and a future working relationship with GIIS.
-sweeping traces…
-line clear
-transmission terminated-
The Island of Rose
10-05-2005, 22:37
A Rosian Soldatoya HMMVW approached the Doominglandi MV-68 and got in front of it, so the Doominglandi soldiers could see it. On top was Staff Sergeant Robert Faw manning the RMG-7A. A 15mm machinegun capable of destroying lightly armored APCs if there were enough rounds fired on it. He did the American salute towards the small window. "Heya." He said over the radio communications thing. "We're going to help you bomb people today, my name is Staff Sergeant Robert Faw. We are part of the Rosian Special Forces, the Rosktai."
Major Roy Johnson, the driver of the Rosian Humvee, waved his hand. His other hand on the steering wheel. "I'm the guy leading the assualt for the Rosktai. My name is Major Roy Johnson, glad to meet you. Briefing said that we were going to assist you in this. Now, I heard of you guys and I know how patriotic you Legionnares are, but. You will have to put that aside, hell I don't know how you could even like blood." He shrugged. "Just let us handle the part of taking the man alive, we're experienced with that."
Staff Sergeant Anthony Cornoti interjected. "Yeah, let us handle that part. We can- oooh, shiny."
Staff Sergeant Jose Menendez sighed, looking at Colonel Johann Lancer. "I'm telling you right now, if a piece of blood gets on my uniform, somebody is going to die."
Johann shrugged.
Robert snickered. "Hell, there's gonna be body parts flying!" He cocked his machinegun for good measure.
Major Roy rolled his eyes. "Right. So do you want us to go ahead and clear it out a bit? The road, I mean. Maybe make a landing zone for the village? Because I know you're not gonna be able to land in a hot zone. Just my opinion, of course."
Shenyang
11-05-2005, 19:51
Revenant rose from his seat and looked at the Base Commander, "When you have a decision, come get me, my men probably need to be checked on, so I'll be waiting for you to send someone for me."
Revenant walked from the room and began toward where he'd ordered the ODST to set-up. When he arrived he saw that the temporary barracks was in place and that light was coming from the inside. He enterred and found his men in the middle of a heated debate about who could take on the entire enemy force alone. Unfortunately by the time Revenant had arrived it had devolved into two sides slinging insults back and forth. Neither side noticed Revenant as he enterred. He took out his SOCOM, reached out the door with it and fired a round straight up. The ODST, brought out of their argument by the gunshot were surprised to see Revenant standing there, wiating for them to pay attention. He holstered his SOCOM, and walked to a table at one end of the barracks. He looked at the ODST, and then he began his debriefing.
Revenant: Sorry that took so long, I think that this whole operation is a bit of a mess, but hey, not our problem. Anyway, that last mission had to be one of our best yet. How many casualties did we have?
The wounded soldier raised his hand.
Revenant: Exactly, one man had his arm zipped by a lucky shot, and howmany did we kill, 3, maybe 4 dozen? That sounds about right. That means that we have a 1 in 48 chance of anyone being wounded, better than most soldiers have of coming back alive... (the debriefing continued for a half hour) ...So in conclusion next time I want us to do even better. After all, who are we, those chump, back-stabbing Inquisitors? No, we're the ODST, the best of the best. Dismissed.
The ODST all got ready to go to sleep, except for Revenant and Polaris, the number two man in Alpha Squad, they had guard duty, not that there was really any threat to the safety of the sleeping men, after all, they were inside a fort, fighting a disorganized, unskilled enemy, still, the guard was kept up, to be sure that no one did attack.
Contract 1
Intelligence: Our scouts have indicated that GIIS has recently set up a small forward listening post in a small farmhouse just north of the western farmland with which to monitor our activities in the area. We believe that the intelligence gathered from this station is largely behind the recent strikes on our operatives in the Lew stretch. We need to teach those bastards to mind their own business. We need someone to go in and clean the place out. There are bound to be a half dozen GIIS men inside, and I want them all dead, but be careful. I hear these guys are lions when cornered. When you finish, destroy the station and any intelligence they might have collected. They probably also have some good gadgets lying around in there. Try to snag one of those listening devices while you’re inside.
Objective 1: Neutralize GIIS supported listening station
Objective 2: Steal a GIIS long-range electronic ear
Reward: 5,000 Genera
OOC: I'll take it.
IC: After driving, running, and riding in various ways and manners, Issaic and his men reached Iovaslav, a pile of rubble that once was a village before the invasion of Buchania a few years back.
Issaic found a small warehouse, and quickly found a table to lay his map upon.
"Alright, from my radio tracker, a listening post is about 2km north-northwest is the listening post. From now on, keep strict radio silence and do not use hand radios, walkie-talkies, and cell phones. They'll intercept the calls and know we are here.
Issaic gathered a few stones and rubble and put them on the table.
"Okay. This red rock here represents the listening post, and each one of these small pebbles represents us. First, Franjo, I want you to find the highest point you can find facing the front and side of the building and find all possible targets and make sure you have a bead on anyone leaving. Jovan, I want you to cover the back and opposite side, got it?"
"Yeah, I get it."
"Alright, next Nikola and Svetlana, you are both Team Red. You'll be the first ones in the post. Your job is to eliminate any survivors. And be wary of any booby traps. Ivan and Andrej will be Team Blue. You'll both be the second ones in the post. Your job is to wipe out any resistence they don't manage. Ivan your job will also be to disable any booby traps or self-destruct device and protect Andrej at all costs. Andrej, your job will be to take what equipment and information you think will be necessary. I will be support, and Alexa will be a makeshift medic. any other objectives will be updated on the spot, got it?"
Also, do not forget that our reward for the ambush of the Krob convoy still stands.
OOC: How strong is the force?
Shenyang
12-05-2005, 00:07
Revenant had been called back to the command bunker. Once there he was handed a folder with the known information on the ODST's next target.
(For Your Eyes Only)
Target 5
Name: Boris Greghov
Known Activites: Sabotage, Raiding Supply Convoys
Intel: This guy’s a dyed in the wool BLA hardman. He runs operations along the highways between the garrisons and the Lew valley, and has a good number of professional BLA scouts and saboteurs at his disposal in addition to the usual foot soldiers. We’ve been seeing a lot of his men probing around Fort Lew recently, and so chances are he, or someone higher, is planning something. Your objective is simple. He’s hiding out in a large camp a few miles west of the Lew highway running from the garrisons to Fort Lew. Capturing him won’t do anyone much good. He’s not one to sell out his friends. So get in there and put a bullet in his brain instead. This should cut off the BLA line of information somewhat.
Revenant: Convoy hijackings, eh? Well, I doubt he'll be much of a threat. Oh, well, he's got important intel no doubt, we'll be back by 00:00 tonight.
Revenant turned and left the room, his men were gathered outside the bunker,eager for a fight, even if the enemy was going to be some crazy farmers with AKs and such. They loaded onto the jeeps they'd stolen previously, this time the jeeps would serve a purpose and unless the ODST found other transport, they were going to be walking back to Fort Lew after this attack, which wasn't a very appealing thought at all.
As they left each man rechecked his gear, not that it was any different than what they'd carried during the last attack, but they knew that they lived and died by the gun, and as a result, making sure your lifeline worked wasn't a bad idea.
After a few hours of driving, and trying to look inconspicuous, which is near impossible in ODST armor, they reached their objective the plan was the same as last time, except that Alpah and Bravo would eter from the front, after they had used the jeeps to open a path.
Once the sniper and exfiltration teams were in position the operation began. Revenant had stressed how this had to be perfect, if the jeeps were even a little off course when they were released, they'd miss the guard sjacks entirely. The steering wheels were fixed in a forward direction, so they'd drive nice and straight, Each was loaded with a 3 pound brick of C-4, on a remote, and bricks were readied to be dropped on the accelerators. At the exact same time the bricks were dropped and the jeeps sped away toward their targets. The guards, oblivious to the danger continued to sleep as the speeding jeeps approached. They crashed into the guard shacks, and the team leaders triggered the explosives. The front gate was left a burning, hole with randomly placed twisted metal.
The sniper teams witnessed the explosions from atop small hills on the opposite sides of the base. As soon as the shacks exploded, men came pouring out of the tents. Each team had a picture of what Greghov looked like, and began picking off the lowly grunts as they ran toward the gate.
Alpha and Bravo advanced toward the gates, in the havoc caused by the jeeps none of the rebels saw them coming. As soon as they reached the edge of the camp they openned fire, a wall of lead sprayed the helpless rebels as they desperately tried to gain some form of control over the situation. Once the rebels at the gate were eliminated, Alpha and Bravo advanced, splitting apart, now each squad would advance on its own.
Epsilon hearing the destruction of the guard houses decided it was time for their move as well. They detonated the C-4 they had placed on the camp's fence, in an instant there was a hole ten feet wide in the fence for the assualt teams to use to escape, Epsilon, its mission accomplished, fell back to the desiganted extraction zone, a mile down the road from the camp, and waited for the other teams to finish their fun.
Sigma and Charlie teams were keeping the rebels pinned down quite nicely, as they exitted they would make friends with a bullet from long range. Through the chaos in the camp they witnessed Alpha and Bravo mercillessly advancing, tent by tent.
In a garage Bravo's team leader noted several hummers, they were the 2-seat variant. The large beds would be perfect to carry the ODST on their extraction. As this was the last building on theri side Bravo held position as one of their men checked each Hummer, they checked out, had full gas tanks, and would run, since they weren't damaged.
Alpha had been advancing slowly, but methodically along their side, each tent they came across they cleared, then moved on. In some they found stacks of weapons, others held bunks, as they reached the final tent they knew they had Greghov, undoubtably he would know it too. Alpha, with Revenant leading, charged into the tent, inside they found Greghov, weilding a Glock Model 18, he threatened to shoot, and at that threat Revenant rushed forward, befor the man could fire Revenant was too close. He landed a heavy blow in the man's stomach, then as he was keeled over kneed him in the chest. The gasping Greghov fell to the ground, from here Revenant interrogated him, but he refused to give any information, as his file had said. Revenant took out his knife, a battle-scarred old combat knife that he'd had since he enlisted in the Snow Guard before his injury, and later return, his victim was face down and Revenant took the knife and with the skill of a trained assassin thrust it through the man's spinal cord, he died almost instantly, his body having lost all function. It had been quick and painless, in a show of respect for a fallen adversary, Revenant closed the dead man's eyes and flipped him rightside up.
Alpha squad exitted the tent, and reentered the hectic firefight outside. They eliminated everything that stood between them and Bravo's location with an expert, systematic precision, by the time they reached the garage, there were no enemies left alive in the entire camp. Each sqaud loaded into a Hummer, and they drove all five they'd found out of the base with a total impunity that they enjoyed thoroughly. The Hummers stopped at the extraction point, and then once all the teams were loaded into the Hummers they bgan the drive back to Fort Lew. When they arrived, true to Revenant's word at 23:50, they were admitted and Revenant left his men once again to debrief the base commander. Meanwhile the other ODST showered and retired for the night.
Revenant gave his debriefing to the base commander, then once he was finished returned to the barracks for some much needed rest.
The Infinite Crucible
12-05-2005, 03:37
Dirk and Jolly were both blindfolded in the back of a pick up truck that was quickly moving through the Buchiaran country side. The BLA hoped that if these two were GE soldiers they would be oblivious to their location. This was hardly the fact for Dirk. If asked where he was he could tell you exactly how many miles you were from the beginning of the trip, how many turns had been made, and even what was wrong with the pickup. He was a genius in all aspects, and this had brought him far in life. It is what had allowed him to reach the second tier of Jeffery Ottomon’s criminal organization and had saved him when he was sold out. It was rumored that he had the potential to be as good as Ottoman some day. That, however, is another story.
After the hour long trip the truck stopped at a Buchiaran training facility. The sounds of patriotic slogans and mock battle could be heard in the distance. Dirk and Jolly were led into a dark room, and there finally they had their blindfolds removed. The grave BLA intelligence officer’s look of intimidation quickly turned to that of surprise. By sheer luck he was one of the two that had met them at the gate to the air strip. He suddenly rose up and whispered some words to the guard and the door was opened. They were free.
Over the next hour Dirk and Jolly debriefed the BLA commander on site about the discovery of their betrayal and escape. This was a grim turn of events for the BLA, but the commander assured them that more double agents were already infiltrating Fort Lew. The commander looked at the two men, and decided to show them the missions that the BLA was giving out to foreign supporters. The two men slowly read over the options and finally chose one.
“We’ll take number three,” Dirk smiled.
OOC: I have something pretty crazy planned for that mission.
Freudotopia
12-05-2005, 19:49
How tagworthy is this thread? Survey says: extremely.
TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG
The Warmaster
12-05-2005, 20:09
FROM: Imperator Jakran Vuell, Commander-in-Chief of Imperial Forces
TO: His Majesty Emperor Antonius
Emperor Antonius,
My master, Sacred Emperor Lucifer, commands me to request of you permission to send a unit of Imperial warriors to repress this rebellion. Auguries have shown that the gods favor a bold response to crush this rebellion, and we hope that this foul uprising will be resolved quickly. To assist in that goal, we will dispatch (with your permission):
Two dozen War-Priests of clan Korne (skilled at all aspects of open warfare, almost unstoppable on the battle field)
Ten Pariahs (elite at long-range combat, with deadly aim)
Seventy Imperial Immortals (The best-trained soldiers in the Empire, elite at all forms of modern warfare)
backed up by air support if necessary Or, if needs be, we can send a smaller force of trained assassins, to eliminate key rebel leaders and other targets. The choice is of course yours. May your endeavors be blessed.
Generic empire
12-05-2005, 21:54
FROM: Imperator Jakran Vuell, Commander-in-Chief of Imperial Forces
TO: His Majesty Emperor Antonius
Emperor Antonius,
My master, Sacred Emperor Lucifer, commands me to request of you permission to send a unit of Imperial warriors to repress this rebellion. Auguries have shown that the gods favor a bold response to crush this rebellion, and we hope that this foul uprising will be resolved quickly. To assist in that goal, we will dispatch (with your permission):
Two dozen War-Priests of clan Korne (skilled at all aspects of open warfare, almost unstoppable on the battle field)
Ten Pariahs (elite at long-range combat, with deadly aim)
Seventy Imperial Immortals (The best-trained soldiers in the Empire, elite at all forms of modern warfare)
backed up by air support if necessary Or, if needs be, we can send a smaller force of trained assassins, to eliminate key rebel leaders and other targets. The choice is of course yours. May your endeavors be blessed.
-encrypting...
-tap trace initiated
-transmitting...
Official Imperial Communique
Sender: Lord Varus Tiberius Alexei
To:Imperator Jakran Vuell
Emperor Antonius sends his regards, and word that he will accept your forces as assets to the Buchianan campaign. You will be put in touch with the necessary authorities once you reach Fort Lew, the Imperial forward outpost in Buchiana.
-end transmission-
Doomingsland
12-05-2005, 21:58
OOC:In response to TIOR's post.
The pilot turned to his copilot with a quizical look,
"Who the hell let them in?"
The copilot merely shrugged his sholders.
The mission commander, Lt. Caius, then got on the radio.
"We're glad to have you with us. Just follow the road and cover us. Once at the village, we'll send men to rendezvous with you."
The other men on the transport were also a bit confused as to why there were Rosians in the base, but for other reasons.
"Wait, TIOR has SFs?"
"Apparently." replied another as he assembled his rifle.
"This should be entertaining." replied the other.
"You have no idea." chimed in a third man, attaching a flamethrower to his rifle.
The rear ramp door of the transport slammed shut, entombing the men within. Small doors on the wings opened up, revealing the thrust fans, and the engines pivoted downwards. Thrust was then applied, and the transport lifted off.
Shenyang
12-05-2005, 22:05
A Shenyangi Assault Carrier had been waiting in possition off the coast of Buchania, onboard were the choppers that were supplying the ODST, and six extras, they appeared to be outdated Cobra gunships, but in reality they were the newest attack helicopter to be distributed to the Shenyang Naval Air Corps. The AH-1X Cobra, internally called the Hooded Cobra. They took off from the carrier, named the SNS Retribution, and began their flight inland toward Fort Lew. The squadron, flying low to avoid detection, reached the coast without any threats. Once they began inland they started having problems. Along the way a BLA convoy was spotted by the lead gunship, Patriarch 1, he ordered his squadron to fan out and attack the convoy at their own discretion. The Cobras began strafing the convoy, not realizing that there was a SA-8 in the convoy. It opened up on the Cobras, immediately recognizing the threat Patriarch-6 made a 180 degree turn and let loose with a Hellfire missile, it sped toward the SA-8, who's crew tried to escape a moment too late, the hellfire impacted, and the SA-8 stopped being a threat and began being a funeral pyre. Once the convoy was thoroughly destroyed the Cobras continued inland. Outside the fort they requested permission to land.
Pat. 1: This is Patriarch Squadron to Fort Lew ATC, do you copy? over.
ATC: Affirmative Patriarch Squadron, you are cleared for landing on pads 3-9, over.
Pat. 1: Patriarch Squadron landing on pads 3-9, over and out.
The gunships, slightly scarred from their attack earlier set down in perfect unison, once the choppers were secure, the crews moved to the temporary barracks that the ODST had so graciously set up for them. They were ready to rest, but as sson as the ODST had a mission for them, they'd be in the air, supporting them 100%.
The Infinite Crucible
13-05-2005, 00:36
Dirk and Jolly were at the crest of the wooded ridge that overlooked the small town that they Generian Army was using as a staging point. Dirk was looking through a high powered telescope surveying the town. At the moment it was around six in the morning and the sun was just starting to rise. Dirk was working out a plan in his mind on how he was going to kidnap the Generian Army commander with two men. Dirk was slowly talking to himself in a hushed tone. Suddenly an idea hit him.
“Water tower, window, sewers, C4, kidnap,” he murmured in quick succession. He smiled he had a plan. The BLA operatives that had escorted them to the location had looks of disbelief on their faces. How could two men kidnap a 40th army officer that had easily a hundred men guarding him? Well, they didn’t know Dirk. Dirk looked up at the BLA soldiers, “This town has a sewer right?”
“Uh… yes sir, it does,” one replied.
“Can we access it from outside of the town?” he inquired.
“Yes, there is a post flood maintenance entrance along this ridge as a matter of fact,” he answered.
Dirk smiled, “Good, bring me and Jolly to it.”
On the brief five minute walk to the drain Dirk explained to Jolly what he had to do. Jolly armed with multiple bricks of C4, a GPS, and a flashlight descended into the stinking inky black depths of the sewers. A few hours later he emerged, devoid of C4. While he was in the sewers Dirk had requested a high powered harpoon gun and a climbing harness which he had specific modifications made to it. All the pieces were in place, now they just had to wait for night to come, and it did.
Jolly and multiple BLA operatives waited outside of town in a forest with an escape truck. Dirk was crossing the field approaching the water tower that stood about one hundred feet away from the apartment building. He quickly scaled the maintenance ladder of the tower and looked out over the town. He took out his night vision scope and harpoon gun. He began to survey the apartment looking for the window he had seen earlier in the day, the one with plush red curtains. “There you are,” he murmured.
He heft up the harpoon gun that had a hundred and fifty feet of steel cord attached to the harpoon and a massive clamp on the back side. He slowly took aim, he only had one shot. His heart beat slowed at his will and he held his breath. He pulled the trigger. The harpoon went flying off into the darkness. He held the gun steady letting the metal cord fly out evenly. The harpoon hit a foot off its mark, pushed by a sudden gust of wind. Dirk cursed under his breath, he may have had skill, but no luck at all. Either way he slowly unwound a few more feet of cord and clamped it the water tower. He then slid to the side of the tower and clipped himself onto the cord. With a push he was off.
Dirk cut through the darkness without a sound. Within moments he was at the side of the window. He took a deep breath an unclipped himself gripping the ledge in front of him. He pressed his ears to the window and heard not a sound. He slowly pushed it open, it wasn’t locked, a careless mistake. He was now ten stories off of the ground. He had reached the commanding officers office without being seen by a soul. No one was in the room, but he knew this was the place he wanted. He noticed that the desk was especially large, plenty of room for him to tuck himself away in. While it was childish, it worked, he was hidden. Minutes began to pass as he waited for the officer to return.
The BLA in the forest were getting nervous. Jolly reassured them, “Don’t worry, he takes his time with these things.”
A full hour had passed before anything happened. Suddenly Dirk heard the door to the room creak open. Two voices filled the room.
“Alright Sir, I will relay the intel to for Lew immediately,” the first voice spoke.
“Alright, good job soldier,” commended the second. This was the commanding officer. Dirk heard the door shut and heard footsteps crossing the room. Suddenly Dirk arose from within the desk with a speed that was unbelievable. In his hand was a tranquilizer gun. The man was hit in the chest before his muscles had even begin to remove to respond to the new threat. He began to fall to the floor, but Dirk caught him silencing the thud. Dirk took the base commander and strapped him on to the back of the modified harness. Dirk had just clamped himself back onto the cord when the door to the office opened again. A young cadet entered.
The look of surprise on his face had only begun to register when he was hit in the forehead by one of Dirk’s custom bullets. His skull shattered and he died a painless death. The two guards in the hall were caught of guard by this. They thought the base commander had gone insane. They both hit the wall wondering what to do. Suddenly a grenade filled with a nerve toxin rolled beside them. It flue open, filling the hall with a bright red gas. They began to spasm uncontrollably and died a horrific death as they broke their own backs from their contractions. Footsteps could be heard coming up the stairs, but the soldiers dared not enter the toxic gas that separated them from the base commander. By this time Dirk was already half way back to the water tower with the commander. He watched as five soldiers surround the window from ten stories before. It was then that they noticed the cord. The ran back inside about to inform the new commanding officer of the turn of events when Dirk reached the water tower. The soldiers were doomed to a death in the fires of war.
Twenty soldiers ran on to the street when something happened. Jolly had pressed the detonator that set of the first wave of explosives that had been placed in the sewers. The ground erupted below them engulfing them in flame and dirt. There last thoughts were of their flesh evaporating off their bodies. Then the second wave of explosives went off blowing out the support for the make shift command center. The entire building came tumbling down. Almost a hundred soldiers within were crushed by the falling building. The few fleeing troops were shot by the BLA snipers on site. Only one was spared a death, he had a story to tell.
Dirk descended the tower and broke for the forest. 40th army reinforcement would arrive shortly, and they had to be gone when that happened. He reached the truck in the forest and the two men were off. A job very well done.
Generic empire
13-05-2005, 01:03
((OOC: Good post, TIC, but one minor correction. He was a GIIS station chief, an intelligence officer not a 40th Army officer.))
The Parthians
13-05-2005, 02:05
Rolling through the night sky, dark and cold, with the turbulent air shaking the transport aircraft like a child with a model plane. Within, the soldiers, Immortals Black Ops troops were checking and rechecking their M-28s, stripping them down and ensuring everything worked while the religious prayed as a chaplain read from the Khorda Avesta, "Ba nãm i ýazad i baxshâyañdeh i baxshâyashgar i meherbãn. Tan-darôstî dêr-zîvashnî âwâyat hvareh hañgat ashahîdâr ýazdãn i mînôyãn ýazdãn i gethyãn haft amshâspañdãn myazd rôshan hamê bê-rasât. în dôâyãn bât, în hvahâyãn bât, hame añdar kasãn ra zartôshtî dîn shât bât, êdûn bât. ýâbârî hvadâ hvadâ-vañd i âlam râ hamâ hañjaman râ." (In the name of God, the bestower, the giver, the benevolent! May there be health and long life, complete Glory giving righteousness! May the visible yazads and the invisible yazads and the seven Amashaspands come to this fair offering. May this household be happy, may there be blessing! May there be happiness among the people of the religion of Zartosht! We beseech you, Lord, to grant to the present ruler, to all the community, and to all those of the Good Religion, health and fair repute.)
Up front, Colonel Dariush Homayounfal looked out with his usual stern expression, scanning his men, covered in ceramic plate and kevlar armor with what looked like gas masks attached to their HUDs and helmets. All of them were heavily armored and armed with advanced technology. They were an ideal force to command, trained since birth and selected from their genetic screen they had taken at the moment they were born. The pilot up front was relaying a message to Generian command.
"This is ARSACES, we request clearance to send in the Parthian Troops."
The Colonel jumped up, and ran down the line of men, putting on his gear and shouting loudly, "Prepare for jump, we are about to go in, you know the drill, hook up and prepare to jump." One hundred and fifty hooks were lined up on bars over the aircraft and the men prepared for the next part, checking their gear as the door in the back opened, sending the men flying out one at a time. The Colonel was the first to go, ripping open his parachute as he fell and sailing down to the ground under a canopy of canvas. Rolling as he hit the ground, he prepared to search around for the rendez-vous point, noticing a pair of M-8 AGS and some M-113 APCs being dropped from other planes.
"Alright what do we have here?" Issaic said to himself. He was looking through his binoculars.
"I've got one sentry next to the door, and another soldier taking a piss to the east." Issaic moved his binoculars.
"Franjo's giving me hand signals. He's got the 'pissing man'."
Issaic tapped Nikola and Svetlana on the soldiers.
"Alright," he whispered. "Move 200 meters to the bushes down there. Cover the front door and the sentry. Don't shoot unless the signal is given."
Issaic turned around. "Ivan, hand me the RPG." Ivan gave him the RPG.
"Alright, as soon as the signal is given move to where Team Red is now. I'll retrieve you and from there we'll enter in through the door together,"
Issaic explained.
Issaic aimed the RPG at the roof of the barn, where a transmitting antenna was. He aimed it and...
... the rocket zoomed into its target. The antenna, as well as a huge portion of the barn, exploded into millions of pieces.
Issaic took out his whistle and blew it. The sound startled the two GIIS men outside. However, it was too late for them. Nikola's RPK-74 ripped through the sentry, his body riddled with bullets. Franjo picked off the other man with a shot to the head.
Issaic waved his hand foward, jesturing for Team Red to get through. They opened the barn door to find a mobile surveilance truck. Nikola and Svetlana bolted to the back of the truck and opened the door. Two GIIS men were frantically trying to destroy the computers and burn intelligence documents and code books.
Svetlana carefully put two rounds into one of the men. The other man swivled in his chair and reached for his pistol but Nikola responded with three shots from his own pistol.
"Shit. I need water now!" Svetlana screamed. The documents were burning.
Nikola grabbed a coffee pot and spilled it all over the burning papers.
"Whew, I'm through. No more action for today please." Nikola said.
When he turned around however, the door to the truck flew open and a GIIS officer fired three shots. Fortunately for Nikola, the truck was higher up than the officer so that three shots hit his leg, instead of, for example, his head. The bullets plunged through his leg and out the other side and continued into the truck, where it richocheted off of the floor before lodging into the driver seat.
"Stay down!" Svetlana yelled. She lunged forward and fired at the officer, striking him in the neck.
As Blue Team rushed toward the the rear door to the truck, they heard the gunfire.
"Damn."
Another GIIS agent, lurking behind bales of hay closed in behind Ivan and Andrej, and aimed his gun.
"Drop it!" Issaic yelled from behind.
The agent, realizing it was hopeless, dropped his gun. "Under the Geneva Convention, I demand to receive fair treatment."
"The Geneva Convention, eh?" Issaic took the butt of his gun and rammed it into the agent's back, sending him sprawling all over the dirt. "Guess what? I never heard of it."
The agent stood up.
"But guess what? It's your lucky day." Issaic said.
"It is?"
"Yeah. You got some codes in that truck."
"I do?"
"And you're going to help me."
"I am?"
Issaic nudged his gun's barrel into the agent's back.
"Oh, I am."
When Issaic reached the back of the truck, however, he received a surprise. The back of the truck was covered in blood, mostly from Nikola.
"I put a tournaquet around his wounds to try to stop the bleeding," Svetlana said. "The bone has been broken in multiple places, and his bleeding pretty heavily. I'd say he'll live, but he needs medical attention urgently."
"I'll get Alexa."
Issaic jumped outside of the truck. "Ivan, guard our prisoner. Andrej see what you can find inside."
Issaic continued to run until he was outside.
"Franjo, sentry duty. Alexa come quick. Jovan, you too. I need you."
Issaic explained the situation en route to the truck. Alexa and Jovan loaded Nikola onto a strecher and continued down the road toward their van, 2km away.
Meanwhile, Issaic made it back to the truck.
"What's the situation, Andrej?"
"They smashed up most of the computers," Andrej began. "This fella by me took a wrench to his computer. And this computer," Andrej said, jesturing to a laptop, "This computer took a bullet for the team. It saved someone's life."
"Any good news?"
"Ah, yes. Fortunately they didn't have time to destroy the hard drives. I've also found bugs and wire taps, a directional microphone, and a radio tracker that can pinpoint insanely well. I've also found the keys to a long-range GIIS electric car."
"Salvage what you can; give me the keys to the car. Svetlana, you're done. get in the car. Team Blue, get what you can, load it into the car, and let's go."
Issaic rememebered to destroy the listening post. He piled the bales of hay into the truck and lit a lighter. As the truck burned, the car took off, but not before Issaic ordered the remaining GIIS agent to strip, and run completely naked as a message to the GIIS.
Issaic painted a green cross on top of the electric car and with the electric car and his van, they snuck across the front at night and finally arrived in BLA territory.
BLA Broadcast from the Front
"Have successfully neutralized the listening post, and have stolen an electric car. Will hand over what we have found. Expect reward. Out."
Wirraway
13-05-2005, 04:11
The crossing of the border was a relativly minor for the 3rd battalion as millitary units had been crossing back and forth for hundreds of years. Thankfully IP-35 continued into Generia and it was a simple task to follow it into the heart of Buchania.
Hector relaxed in his command track, savoring the smooth ride of the highway while it was still possible. With intent eyes he watched the flat farmland of Southern Generia roll past him through the APC's window slits.
Shifting slighty in his seat, Hector glanced at the GPS display on the armored wall. He looked on as a computer generated version of his unit rolled down the highway. In a bar on the right almost all the vehicle status symbols glowed a pleasant green. The single point of red emanated from Lieutenant Coffey's M1A2 Abrams which was suffering from a worn transmission casing, just as his XO had predicted.
It would be another few hours before they reached Fort Lew and began the operation in earnest Hector took advantage of this like any astute commander would, he went to sleep.
Doomingsland
14-05-2005, 13:51
OOC:Bigass post coming sometime this weekend.
Freudotopia
15-05-2005, 01:24
Antonius--
I am enraged, to say the least, at the latest Buchanian trouble making. Their meddling will be put to an end. They are unworthy to even face our wise and powerful Generian allies on the battlefield. If it would please you, I will send a specially chosen force, Task Force Iron Maiden, to Generia at once. They will assist the 40th army in any way possible, both in actual fighting and the extermination of your determined targets. I assure you, they are the best light fighting force in the region, and will strike hard and without warning at the heart of our enemies. They will rue the day they were born. Onward to bloody victory!
–Saul Hudson the Illuminator, Emperor of Freudotopia
Task Force Iron Maiden
Commander: General Victor Orlov
Personnel: 176 combat, 24 support
Equipped: Standard Issue Freudotopian Infantry equipment, including GIR-37x (Scaled down version of Generian Heavy assault rifle), FP-77 .44 cal. pistol, Syen fighting knife
Combat Personnel Breakdown: 40 vehicle crew, 100 infantry, 12 reconnaissance, 20 heavy assault, 4 intelligence officers.
Vehicles: Eight LCV “Cobra” Armored Cavalry (crew of five)
AUTHORIZED FOR ANY AND ALL FORCE NECESSARY TO ACHIEVE OBJECTIVES ON GENERIAN SOIL
-Four Combat Cells: Each consisting of:
2 LCV (ten crew total)
25 Infantry
3 Reconnaissance
5 Heavy Assault Troopers
1 FESS Intelligence Officer
Cells will operate in conjunction with each other and independently.
LCV “Cobra” Armored Cavalry
Max speed: 60 mph
Cruising speed: 45 mph
Armament: 2 Lambent .50 cal machine guns, 1 110 mm turret (sabot rounds, AP rounds),
1 R-38 Rocket pod (24 laser-guided rockets)
Weight: 22.4 tons
Length: 23 feet
Width: 8 feet
Height: 6 feet 11 inches
Engine: Intron 1400 hp gas turbine
Crew: Driver, commander, loader, two dedicated gunners.
Task Force Iron Maiden:
Current Status: En Route to Generia
Objectives: None Current
Casualties: 0
The Island of Rose
15-05-2005, 01:32
The Rosian Humvee started going down the road.
(To Doom, Doom I'll make a fancy post after you post x.x)
Borman Empire
15-05-2005, 01:37
Alright. Summary? Im getting back into NS so I can take part.
Freudotopia
15-05-2005, 01:59
General Victor Orlov to High Military Command...
"This is Orlov, you contacted me?"
"Yes sir, this is Sergeant Alexander in Gen. Leiter's office. You are to proceed to New Bucharest immediately with your task force. Upon arrival, wait for a contract from the Generians, and then report back to us. We may have a special job for some of your intelligence attaches, one that could wrap up this unfortunate situation in Durthmont."
"What are you saying?"
"Archibald Smythe has been arrested by Epsilon Corps for conspiracy to rebel against Freudotopia. Did you know that he's anything but a true Freudotopian?"
"I certainly did not!"
"Indeed. He's half Ismerian and half Buchanian. Apperently he managed to hide the fact quite well."
"Who turned Smythe in?"
"Someone named 'Boo Radley' I think."
"Never heard of him."
"Me neither. Apparently he was organizing criminal cells and preparing for a major rebellion to coincide with the one you've been sent in to stop."
"Holy shit? You're serious? This could have major implications for the whole Bornerifreudic Empire!"
"I agree sir. In fact, I have a message from the Emperor himself. He says to annhilate these Buchanian scum utterly, to make an example of them."
Orlov smiled grimly.
"Oh, that is precisely what I intend to do, Sergeant. Orlov out."
The dark green helicopter continued to roar across the night sky, bound for Generia and the chance to spill the blood of Freudotopia's enemies.
Generic empire
15-05-2005, 03:39
-transmitting cipher link
-beginning encryption process
-transferring cipher pad
-code 19738653210912378465
-beginning encryption process…
-28% completed
-49% completed
-72% completed
-encryption completed
-transmitting files
To: Mr. Black
Sender: Nikit
RE: “Eddie”
Division has been made aware of your interests in the area, and has determined that they are not in conflict with our own. Studying the recent developments in Freudotopia, I can only say that your proposal is a most favorable one. It is indeed a disturbing prospect to observe the turning of the colonel, and with the arrest of Jonathan Cac and subsequent purge, I add that GIIS is finding itself in a rather unenviable position. It is my opinion that until the Agency pulls out of lockdown and cellular isolation, we have very little room for movement in Buchiana, and knowing the information control care even under ordinary circumstances, division will be very short on tertiary source intel.
Thus it is necessary to gain whatever primary and secondary source intel we can, and so where I haven’t the power to authorize your proposal directly (I doubt at this point in time that anyone would find themselves with that power, at least not until GIIS finds itself another monkey boy to run the suits on the seventh floor), I can give you the blessing of Division-13, which, in your circles at least, is as good as direct authorization.
Unofficially, I am allowing your creation, mobilization, and deployment of Task Force: Eddie, a unit that will be placed directly under your control, to be used as your particular discretion dictates. I bid you remember however, that while you have my blessing, there are to be no official records or mention of this unit outside of our particular confidence. The consequences of a leak would be catastrophic, though I am certain you are aware, as we have often made it our business to walk the line between invisible success and catastrophic failure the likes of which the world has never seen before.
Following the transmission of this message I will break off all contact with you and the men of TF-Eddie. Their files will be erased as yours have. As you have already reassured me, there are no human sources of trace for the members of the unit, and seeing as you have confidence enough from me to allow me unofficially authorize this little foray into the forbidden realms, it is a given that you have my confidence in all other related matters such as human sources. As of now, everyone in this unit is officially as dead as you are. More so, they never existed.
It is with this that I bid you goodbye and offer my deepest most heartfelt prayers for the success of your endeavor. I do believe that the fate of Generia may hinge upon your success, however I struggle to find a time when it did not.
Godspeed, Mr. Black.
In friendship,
Nikit
-tap trace initiated
-line clear
-primary erasure process initiated
-terminating line set 1
-terminating line set 2
-terminating line set 3
-erasing pad
-removing pad from database
-transmission terminated
-line dead
Generic empire
15-05-2005, 04:18
-encrypting...
-transmitting...
Official Imperial Communique
To: Emperor Saul Hudson The Illuminator
From: Emperor Antonius The Perpetually Hungover
Your outrage is echoed here in the halls of the White Citadel and throughout Generia, friend, for a crime so heinous as this is to be considered a crime against the entirety of Generia and the whole of the Bornereutopic Empire. With regard to recent action dealing with the Ismerian cartel, I can only add that I hope you found the services of our agents useful, though unfortunately I am unaware of the extent of GIIS involvement or deployment, as I find the policy of non-involvement with regard to their operations to be the most favorable to my own health and sanity. However, I do presume that your agents in country will be working closely with several familiar faces, though I also stress my regret over Mr. Cac's treason which led to the inflow of Generian weaponry and personnel into Durthmont and Ismeria. I am not sure of the current state of his existence on this Earth, though I can assure you that his treason will not be taken lightly.
Again, my personal thanks and those of the Generian populace go out to you.
Emperor Antonius I,
Supreme Imperial Majesty of the Empire of Generia
-transmitting cipher link
-beginning encryption process
-transferring cipher pad
-code 12929457482919283743
-beginning encryption process…
-28% completed
-49% completed
-72% completed
-encryption completed
-transmitting files
Sender: Nikit
To: His imperial Majesty, Saul Hudson the Illuminator, Freudotopia
Your enlightened grace, a humble pawn sends his greetings to you. I come to you bearing information that your grace may find useful noticing your recent interest and involvement in the Buchianan campaign, so closely related to your own recent covert wars in the city of Durthmont. It is my wish that the details below be kept in the utmost confidence. Noticing the state of GIIS and your own intelligence networks following the trace of internal links including both Archibald Smithe and Jonathan Cac, we cannot risk a leak.
I have been monitoring the official Imperial sub-official encryption channels, and have noticed that within the past half-hour you received a response from his Imperial Majesty, the Emperor of Generia. As the Emperor recognizes the need for total clandestine security within the intelligence maze of GIIS, he remains uninformed of the details of most intelligence findings and other clandestine operations. Thus it falls upon me to inform you of the situation as we stand.
Currently, GIIS has entered a total lockdown. During a total GIIS lockdown, the various divisions are completely isolated from one another, physically and electronically, to prevent the translational movement of moles and compromising information data between divisions, or, in a worst case scenario, out of GIIS. The divisions have been further subdivided into cells and operational task forces and thus GIIS largely finds itself a crippled body for the time being. However, due to necessity, some divisions have been granted limited provisional operational status in order to carry on with whatever tasks were occurring at the time, but were unrelated to the Ismerian incident.
Due to my efforts, my division, Division-13 has been granted similar provision, along with additional operational privileges that allows us to function at full capacity. I will add that it was division-13 that was handling operations in Durthmont behind our front division, which has undergone a near complete purge on account of corruption.
Jonathan Cac was never aware of the operation of Division-13, or that we had final say in what occurred in Durthmont, which allowed us to eventually trace the ‘Generian Link’ back to him and deal with the problem. However, in so doing we have also left GIIS headless, and so it is my decision that Division-13 takes matters into its own hands. I am taking up the reins of the covert wars in Buchiana, as it is crucial that this problem be dealt with. However, it is the opinion of my esteemed colleague Mr. Black, whom I believe you have met and had dealings with before, that this situation be used to our advantage to flush out the remaining deep cover moles throughout the NOC battalions of GIIS. Buchiana is a hornet’s nest, and it is rapidly filling with GIIS refugees. Mr. Black is going to be leading the charge on the ground against this second sub-front, though he will remain incommunicado throughout. Therefore, you should be dealing directly with me with regard to future concerns about this entire, fucked-up situation we find ourselves in.
Your most Humble Servant,
Nikit
-tap trace initiated
-line clear
-primary erasure process initiated
-terminating line set 1
-terminating line set 2
-terminating line set 3
-erasing pad
-removing pad from database
-transmission terminated
-line dead
Generic empire
15-05-2005, 17:30
-beginning encryption process
-initiating narrow broadcast
-transmitting…
Sender: Rostislav Mareki’ev
To: Issaic
Excellent work. That should curtail the GIIS spies in the region, for the moment at least, paving the way for larger operations on our part. This brings me to your next assignment. You have proven to us time and time again throughout the occupation that you are more than capable of managing BLA operations without direct control, and so Nikolai has seen to give you a degree of autonomy in the next assignment.
We have a problem. The 40th Army has been pouring troops in through the Alexian pass in the north of the country, and with this pass in their hands, they have a near limitless supply of reinforcement with which to wreak havoc on us. If this pass was to be made unavailable, then our operatives and the members of the fledgling Buchianan National Army would stand a much better chance of surviving this first stage of the war. Quite simply, I want you and your unit to get up there and close the pass. As you know, the winter months are coming fast upon us, and the heavy snows in the mountains will remove all hope of clearing the pass until spring, giving us more than enough time to get the BNA on its feet, and take the fight to the 40th.
Nikolai trusts you, and so I trust you. Do not disappoint us.
-tap trace initiated
-transmission terminated
Kroblexskij
15-05-2005, 19:24
OOC: waits for inevitable ambush on heli convoy
memo - 16 helis , take your pick!
6 BMPs and mech squads, they're vunerable people!
Freudotopia
15-05-2005, 22:58
-Establishing Handshake Protocol
-Matching Ciphers
-Ciphers Matched
-Encrypting
-Message Encrypted
-Transmitting...
Nikit-
As you know, the task force which has been entrusted to me is fast moving, well-trained, and surprising. It will be a formidable asset to your efforts in Buchania. However, we do not have as much destructive power at our command as I would like. Therefore, I formally request that Task Force Iron Maiden be aided by the nuclear submarine Ozzy. It is stationed off the coast of Buchania, and has a full complement of cruise missiles to use at my command. The craft is under the command of Captain Gregor Orlov, a cousin of mine. Also, I would ask for the 37th wing of the FAF to be granted authorization to fly missions into Buchania to support my force. The wing consists entirely of F/A-12 Blizzard fighters armed with air to ground and air to air missiles to be used at my command. The wing is commanded by Colonel Matthew Ludlum, a decorated and capable pilot. I expect authorization soon. Buchania will rue its rebellion once I am through with it!
For the glory of the Bornerifreudic Empire,
Victor Orlov
-Message Transmitted
-Initiating Trace Search
-Search Complete
-Dropping Line...
Generic empire
15-05-2005, 23:05
-transmitting cipher link
-beginning encryption process
-transferring cipher pad
-code 12929457482919283743
-beginning encryption process…
-28% completed
-49% completed
-72% completed
-encryption completed
-transmitting files
Sender: Nikit
To: General Victor Orlov
I will see to it that General Nriv'ka authorizes your requests. So long as your support operations stay clear of Imperial troops positions you should be fine. If there is anything more you require, don't hesitate to contact me.
-Nikit
-tap trace initiated
-line clear
-primary erasure process initiated
-terminating line set 1
-terminating line set 2
-terminating line set 3
-erasing pad
-removing pad from database
-transmission terminated
-line dead
Freudotopia
15-05-2005, 23:10
The helicopters touched down on pad #18, one of dozens on the airfield of the Northern Garrisons. As soon as they hit the tarmac, soldiers began pouring out of them. The full number of combat personnel was 175, all trained, ruthless killers who would give their enemy no warning before annihilating them. They would engage both the BLA and BNA as the situation required, and adapt to any combat situation with calm, prepared readiness.
These men were some of the best the Freudotopian Imperial Army had to offer, and their commander, General Victor Orlov, was as bright and capable an officer as could be found. He leaped from the chopper with the rest of his soldiers. He could have had a private transport, but he thought it an insult to his men. Straightening his uniform, as high officers will do compulsively, he approached the young man who had waved the helicopters in. Receiving a sharp salute, he returned it and spoke.
“Task Force Iron Maiden reporting for duty.”
“Sir, yes Sir. I have instructions to lead you to the officer barracks. Your soldiers will be billeted in barracks 13A. The main garrison is just a short ride away. Several trucks are waiting for us. Also, my controllers tell me that your vehicles are inbound on a heavy transport plane, and will arrive in approximately ten minutes. They will be placed in combat readiness in the 13 garage. Is everything to your satisfaction, General.”
“Most certainly, soldier. Take me to my car.”
The military jeep led the seven troop trucks along the wide road to the Northern Barracks, where they would stay until receiving their first assignment.
Generic empire
16-05-2005, 00:09
Late that night, General Orlov was awakened by a heavy knocking on the door to his quarters, an officers room, Spartan in finishing, but comfortable and larger than most. As he called for the knocker to enter, surreptitiously fingering a pistol under the desk where he sat, studying the intelligence data he had been given upon his arrival, the door slowly opened, and a young Generian officer entered, and saluted.
“I apologize for disturbing you at this late hour, sir, but General Nri’ev has just come in from fort Lew, and requests your immediate presence in his headquarters.”
Standing and stretching, General Orlov fixed his uniform, and followed the officer to a waiting jeep outside. A few minutes later, after a recklessly fast trip through the empty streets of the massive military complex, the jeep halted in front of a large grey building. From the rood hung the flag of the Generic Empire, the Bornerifreudic Empire, and the standard of the Imperial fortieth army. The lieutenant stopped the engine, and led General Orlov through the heavy doors of the building. They made their way to the third floor of the command building where General Nriv’ka’’s office was located.
“Go right in, sir. He’s expecting you.”
The lieutenant saluted and excused himself.
As Orlov entered, his eyes fell upon a rather disheveled looking officer of average height and powerful build. General Nriv’ka looked up from his work, and recognizing Orlov, got to his feet.
“General, come in. Have a seat.”
General Nriv’ka was a gruff soldier’s soldier, a true product of the Imperial army, foul-mouthed and brilliant, with a fanatical passion for all things dealing with war and conflict. Now heavy black circles grew under his eyes as the smoke trailed from a dying cigarette languishing in an ashtray on the desk before him.
“I’m sorry for calling you here so late, but I wanted to talk turkey while I’m here in person.”
Nriv’ka sat down again, and beckoned Orlov do likewise.
“Now, as you might have read in the briefing, my boys of the 40th are getting ready to overrun the strip and move into Lew Valley, where most of the BLA boys are holing themselves up. Rumor has it they’re putting together an army. Mostly farmers and shopkeeps from what I hear, but I’m told they’ve put an old Buchianan war vet in command. Say that if anyone can build the BLA a fighting force its this guy, General Vassily Bjeylic. This guy knows as much about training and tactics as I do, and if he can pull this little stunt off, the Buchianans could be going on the offensive. My job is to make sure that doesn’t happen, and the way to do that is to clear the rodents out of the Lew.
Right now I’m just waiting for some of those foreign guys down at Fort Lew to finish up clearing out some nests in the strip, and getting my own divisions into position to make our play. However, I’m getting a little stiff just sitting around up here waiting, letting the BLA get their own boys ready to fight us, so I’m going to send down a little probing operation to feel out the enemy strength in the area.
Here’s the situation as far as we can see it. Right now, the Buchianan National Army is still in training, and until that’s done it’s just us against the BLA. That’s not saying it’s going to be any easier though. Most of the guys in the Lew valley have been fighting us in Buchiana for six years. They know the terrain like the back of their hands, and they won’t hesitate to use that against us. They’ve got tunnels, chokepoints, mountain hideaways, and all manner of other shit mapped out and fortified down there, and when we push, they’re going to push back. Hard. Knowing Bjeylic and his methods, the first batch of he BNA won’t be in operational readiness until at least the spring, which means that the BLA is going to be our primary enemy throughout the winter. If you’ve never been to the Lew, I’ll tell you that the winter there is far from mild. I’m expecting that our armor isn’t going to be of much use until the passes clear. What that means for you is that Task Force Iron Maiden is going to be doing a lot of work in congruence with our operations down there.
As I’m sure you gather, this isn’t going to be an easy job. If we’re going to have to fight the BLA on their own terms, we’re going to have to beat them at their own game. I’ve read up on TF: Iron Maiden’s specialties, and I know that this is gonna be right up your alley.
One of the GIIS boys forwarded me your request to utilize your own fire support. I got no problem with that so long as you keep your explosions away from my troops. As your reputation proceeds you, I’m more than willing to give you a degree of autonomy in your operations. Your soldiers tend to act like professionals, not like those Doomingsland clowns down at Fort Lew, so I know I won’t have to babysit you. Expect to be getting some of the trickier contracts and operations straight from me. I’ll be counting on you to get the job done, making my life and the lives of my men easier. Like I said, expect to be working alongside our own special forces units, especially in the Lew Valley. If things get hot like I think they will, we’re all gonna need all the help we can get.
At the moment though as I mentioned we’re gearing up for some probing operations in and around the valley, to get an idea of what the BLA has in store. Limited skirmishing and scouting ops are going to be more or less the order of the next few days until my main force moves in. Simply enough, I want you to get down there and scout BLA troop strength, fortifications, possible ambush points, command centers, relay centers, and equipment from small arms to armor to air vehicles. In three days we move, regardless of whether the foreigners have finished up with their contracts. I need as much info as I can get before then. I don’t trust GIIS, never have. They tend to withhold things from me, and I don’t approve of that. Thank them for your new job.”
General Nriv’ka gave Orlov a moment to let the information sink in, before standing and extending his hand.
“There it is, if you’re up for it. If not, the door’s right behind you. I look forward to working with you. I got a feeling these BLA assholes are gonna have some serious second thoughts about pissing us off.”
Nriv’ka grinned and shook Orlov’s hand.
Wirraway
16-05-2005, 18:13
To: Generic Imperial Millitary Command
From: Wirrawayan Department of War
The 3rd Batallion is in position outside of Fort Lew and awaiting orders.
Freudotopia
16-05-2005, 20:33
Orlov stood, and saluted General Nriv’ka.
"Sir, my forces will leave for the Lew Valley immediately. You have our full support. If you will excuse me, I should get at least a few hours of sleep. I'll be up at 0500 hours to get my boys on the move."
"Very good, Orlov. I've heard very good things about you. Do not dissapoint me."
"No sir."
"Excused, General."
With another salute, Orlov turned on his heel and marched out of the office. General Nriv'ka seemed quite competent, if a little blunt, but Orlov could deal with blunt. This partnership would likely be quite fruitful.
The lieutenant was waiting outside, next to the parked car. Orlov gestured, and the man jumped into the driver's seat. A short car ride later, Orlov disembarked at the officers quarters, ready for a solid three hours of sleep. In the morning his entire force would mobilize, and would be on full combat alert, ready for action at a moment's notice. Before he tumbled into his bed, Orlov dispatched a quick message to his compatriots, Gregor Orlov and Matthew Ludlum.
Mobilizing at 0600 hours. Full combat alert status. I will be in radio communication starting at 0530 hours tomorrow. Await my orders.
Orlov fell into bed and was asleep before his head hit the pillow.
Generic empire
18-05-2005, 19:23
((OOC: Due to a severe lack of posting on the part of those who have outstanding contracts or orders, I am ordering a roll call, the first of one to occur weekly for the duration of this thread. Everyone who still intends to participate MUST post their intention to continue IN THE OOC THREAD BY MIDNIGHT THIS SATURDAY EST TIME. The link to the OOC thread can be found on the first page, post 4 or 5. Thank you for your cooperation. I will expect IC posts shortly following the OOC posts.))
Doomingsland
18-05-2005, 21:27
OOC:Finally got some free time, whew.
IC:
As the MV-68 drew closer to the listening post, the rear ramp door dropped, filling the troop comapartment with fresh air. The compartment's gunner threw a switch, and a GAU-19 12.7mm gatling gun folded down from the ceiling. The gunner then walked over and manned the weapon, covering the rear of the VTOL.
The assigned LZ was just outside of the town...
OOC:Argh, no more time, post more later.
Nikola moved back to New Buchiana due to his injuries and healing time. He was never sadder in his life, but decided to help the BLA there until he was able to rejoin Issaic.
Meanwhile Issaic moved up north, to the Alexian pass. Issaic and his group moved throughout the pass, looking for some BLA.
Jovan and Svetlana, who had both become accustomed to each other, were tagging behind Issaic, followed by Ivan and Andrej at the rear. Franjo, usually the quiet one, preferred to be more with Issaic, who too was a quiet person, and ahead of everyone else.
“C’mon Svetlana, you and I make an excellent team,” Jovan said putting his arm around Svetlana’s shoulder.
“Quiet or I’ll blow your brains out with your own rifle,” Svetlana said jokingly.
“Look at those two lovebirds,” Andrej said.
Ivan yelled “Get a room!”
“Shut it Ivan!” Jovan yelled back.
“You know, those thing are bad for you,” Issaic said to Franjo, who had a cigarette in his mouth.
“What? Stupid leaves wrapped in paper? I’ll take my chances with this, rather than a Generian bullet in the back,” Franjo said back smiling.
All of sudden he paused. He thought he heard rumbling in the brush above him. Issaic stopped too, soon after with his AK drawn.
Jovan and Svetlana, completely unaware, continued to talk and almost walked into Franjo. Ivan and Andrej, aware of the sudden quiet that had suddenly come over all of them, looked around to see why everyone suddenly became so quiet.
A man stood up out of the bushes above them. “Hands up.”
Issaic pointed his AK at the center of the man’s chest, and Franjo already had sniper rifle pointed at the man, too.
“Drop your guns.”
“Bite me!” Svetlana in a flash drew her pistol and aimed it directly at the man’s face.
“Try it, and you die.”
On further notice, there was not one man but eleven, guns drawn, completely surrounding the group in a variety of camouflage hiding areas.
Issaic said, “Take me to see Uralya.”
“Put down your weapons.”
Issaic gestured for everyone to put down their guns.
“Good, good. Welcome to the Alexian Pass my friend! Ha ha! We kill those bastards together now, right?”
Issaic was completely confused. He thought the man was speaking Buchianan, but it sounded heavily accented to the point of mutilation. He recognized a few Buchianan words, but also a few Generian words, but they were accented so much he couldn’t understand them.
The man, noticing Issaic’s confusion, spoke more slowly and said “Ah, common problem. Buchianans cannot understand the language of the men of the mountains. We speak, how you say, differently. In case you were wondering, I am Uralya, Ivan Uralya, but as I heard you already have an Ivan, thanks to this feisty lady you have traveling with you, so call me Uralya.”
Uralya took the group up to his camp. It took a few days for Issaic to get use to the accent, and everyone except Franjo never did get used to the accent, but Issaic used the time in Uralya’s camp to get familiar with the terrain from the maps and get used to the “mountain men”, as they referred to themselves.
“You see,” Uralya explained around a campfire “Our lives here follow a cycle. Traditionally, our lands have always been invaded either from the south or the north as rulers and armies clash to get the other’s land. We, my friend, are in the middle of the fighting! We fight for our homes. We fight for our women. We fight for our children and generations to come. We fight for our culture. We fight to live and live to fight! Each day, we drink to those who have died, but we fight for their honor the next. As our parents say, for every one of us that dies, ten more spring up into place! And we don’t care if we die, we know God is on our side. Glory to us all!”
Uralya raised his tin cup in a toast.
“Now we have new friends that will help us fight these barbarians that invade our homes. He helps us fight!”
Issaic looked around uneasily. “We’re not here to fight your war with you. We’re here to block the 40th from getting through. I’ve got some TNT and C4 and I’m going to blow the passes up, and I want you to help.”
Issaic was referring to the Alexian Pass’s geography. The Alexian Pass wasn’t just one pass but three that join up to combine into one giant pass south in the valleys of Buchiana.
“Now I’m gonna need help to set them up. But if it works, if we can block the three passes, it should block the main contingent of the 40th from getting through until spring,” Issaic said. “Are you going to help me?”
Uralya, completely taken aback by Issaic, began to think. He had thought the BLA had sent Issaic to help defend his homeland, but saw that the BLA’s true intentions were to only prevent the 40th from attacking south and didn’t care a damn about the people of the Alexian Pass, who were most likely going to bear the brunt of the Generian revenge that was sure to follow such a brazen act.
“I owe Nikolai, I do this for him. But tell that slippery bastard that he better said REAL help ASAP when you see him. Agreed?” Uralya offered his right hand.
“Agreed.” Issaic shook his right hand.
“Alright, a deal. Let us eat now. No more talk tonight. Tomorrow is a big day.”
Everyone took food out of the pot over the fireplace and began to eat.
Shenyang
20-05-2005, 02:53
Revenant left the fort for a short time; he met with an SCI agent who was working in the area. The agent handed Revenant a sheet of paper, on it was a report on a BLA barracks that had been set up 300 miles east of Fort Lew, Revenant and the ODST had orders to take it out. The report stated that there were approximately 200 men in the facility, and that afterward the barracks was to be destroyed via cruise missile. Revenant finished reading the report and tripped the small lighter at the top of the page; the gasoline soaked paper immolated itself, leaving no trace of what it once was. He returned to the base and briefed the base commander of his orders; he was given permission to use the SNS Valiance for a single strike. He gathered the ODST, and they set out for the barracks.
Approximately three and a half hours later, the ODST reached Waypoint Omicron, this was the prestaging point for the assault, and the squads were given their position assignments.
Epsilon: Guard the Humvees and provide extraction after the assault is complete.
Sigma and Delta: Sniper teams, stationed on either side of the main gate.
Alpha and Bravo: Assault teams; stay silent as long as possible, infiltrating through the perimeter fence on either side of the main gate.
The ODST reached Waypoint Romeo; this was the extraction point, from here the sniper teams moved to their posts. They silently eliminated the guards in the guard towers, as well as those in the main gate guard houses. Once the infiltration points were cleared Alpha and Bravo advanced through the forest surrounding the facility and prepared to cut the fence. Along each section of fence a pair of guards patrolled hugging the tree line. They were fatigued from several hours of patrolling. This gave the ODST the edge they needed. As the guards passed they were grabbed and silently dragged into the forest, where they were killed and hidden. Now that the way was clear, the squads advanced.
They reached the fence and cut their way in. Once inside the squads split into four man fireteams. Each began to secure one of the nearest buildings.
Revenant's team entered the western garage; inside they found several transport trucks, a few jeeps, and four patrolling guards. As they prepared to eliminate them, one guard saw Revenant's team and opened fire. He ran to an alarm panel and pulled it. A moment later a blaring alarm filled the camp.
Revenant: Oh hell, assault teams, go loud and fire at will.
Revenant drew a UMP and a katana as Nighthawk eliminated the guard who had seen them with a burst from his AK-110. Revenant charged a guard, who was too frightened to fire, and quickly beheaded the man before he could even scream. Revenant wheeled around and fired several rounds into a guard who had rounded the corner; he went down not knowing what had killed him. The last guard hid under a jeep and attempted to trip another team member Caldera, however his training made Caldera reach down, drag the man from under the jeep by his wrist and bury his combat knife in the man's chest. He kicked away the man's gun. Then he saw he was bleeding, his thigh had been zipped by a passing round, tearing the fabric and creating a wound that looked much worse than it actually was.
Revenant gave the order to continue to the next building.
Meanwhile in the other garage Seraph's (leader of Bravo Squad) team had managed to catch the guards while they were all talking in the far corner, They opened fire on the unsuspecting guards, who fell before they knew that Seraph's team was there. Seraph's team advanced into their second building, a barracks, this one was totally empty, the men must have been in the mess hall, across the main road in the facility, they could here intense gunfire, they knew that Secondary Team A was giving the men in the mess hall hell, as no yells in Shenyangi could be heard. It was standard field craft for the ODST to speak only Shenyangi when in the field unless speaking with a foreign individual. As a result they knew that none of the ODST was injured very badly.
Secondary Team B had found their building to be an empty barracks, none the less they advanced and made sure that there were no important documents in the room.
Revenant's team entered their second building and found around 34 enemies inside, the ODST quickly fanned out, firing into the tightly knit mass of enemies. The BLA soldiers reacted quickly, diving for their weapons and returning fire, bullets ricocheted off Revenant's armor as he drew his M249. He saw the BLA men recoil as he drew it, and watched them drop, as though in slow-motion, once he fired, a round grazed his helmet, and he shrugged, it wasn't a damaging hit, just another battle scar for his armor. Once the men were dead the ODST cleared the room and prepared to enter the next building, the communications building.
The other teams advanced into their next buildings. As did Revenant's, as they entered the communication building they realized that this building might have a lot of useful intelligence. They would have to be careful with their fire in here. Revenant drew his SOCOM, and the other ODST drew their sidearms, each of which was different, as ODST provide their own sidearms. They threw a flashbang into the main room and burst in; they picked off each man in the room, knowing that taking prisoners was entirely out of the question. They had neither the resources nor the time to take prisoners, and these men couldn’t tell them anything that their equipment couldn’t. Revenant found a contact list and a book of radio frequencies, the BLA had some pretty advanced communications gear, for example access to frequency hopping radios, which jump to random frequencies to avoid being listened in on. They also had access to an encryption program that Revenant had never seen before. He took the code book, as well as a copy of the encryption program.
Once they were satisfied that the building was clear they moved on. 5 minutes later all the teams met at the end of the main road, they saw that it had been flooded with enemy troops while they were clearing the buildings, no doubt they were reinforcements. Revenant called for the AH-1s to sweep the main road for them, he also ordered the sniper teams to fall back to Romeo. All six Hooded Cobras cut low over the trees and then opened fire on the reinforcements, they flew in an odd formation so as to hit every angle with fire, they cut over the barracks at 70 miles per hour, and after their first run were ordered to return to Fort Lew. The Alpha and Bravo sprinted toward the front gate, firing on the survivors of the attack, once they reached it they boarded the humvees which Epsilon had brought forward and peeled away under light fire.
Revenant: SNS Valiance, strike is a go repeat strike is a go. Fire a four missile salvo at the indicated coordinates.
The Valiance, who had been on station for the past week, awaiting this exact order.
Captain: All hands, prepare to fire, helm, take us to launch depth.
Helm: Aye sir, launch depth achieved.
Captain: You may fire four missiles when ready.
Fire Control: Firing VLS battery 1, estimated time to impact, 2 hours.
The Katana cruise missiles flew low over the landscape, leaving a sonic boom in their wake as they moved at Mach 1.25 toward their target. When they arrived they executed a terminal pop-up and then dove straight down into the facility. The missiles air-bursted and totally leveled the barracks, the ODST saw it from a hill several miles away, the facility erupted in a ball of fire. Once the smoke cleared it was evident that there was no facility left, only a large crater. Once this was complete the ODST checked to see how many of their own were injured. They found that only five of them were injured at all, but one of those injured was in worse condition than expected, he had been hit by an errant round, and was bleeding much worse than expected, Revenant did his best to stabilize the bleeding, once that was done they loaded up into the Humvees and began the trip back to base.
Freudotopia
22-05-2005, 22:21
Bump
Freudotopia
22-05-2005, 22:40
As the parachutes hit the ground in the dense forests of the Lew Valley, Orlov looked at his men. They seemed ready for anything, and he himself was feeling better than ever now that he was back in a combat zone. Although he was an inventive and bold strategist and combat analyst, his calling had always been in leading men, being on the front lines. His body armor felt more natural than his dress uniform, and he smiled as he directed his men to unload their LCVs and supplies.
The LCVs crashed through some dense thickets, and Orlov, in the lead one, had his GPS locator out, knowing that they were near the place that General Nriv’Ka had assigned them to construct a small forward base. As their force was very small, it would serve as little more than an intelligence outpost for the moment. On the Generian side of the valley, out of range of any of the BLA’s weapons, the base would be set up over the next few days, and the men would be sent out in routine foot patrols. The forest, more like a jungle thought Orlov, was thick enough that the LCVs were considerably slowed. Even now, they were making barely any progress through the undergrowth, but they had not far to go now.
As his men broke through the last line of trees, they stopped. The same thought was running through most of their heads. THIS is the camp? Even the intelligence officers, arguably the most comfortable in such a vulnerable situation, were uneasy. The space could barely be called a clearing, as isolated clumps of trees were scattered across the grassy area. Orlov, however, was satisfied.
“Men, I know this place looks like shit, but it’ll be better than you think. They trees break up the outline of the clearing, making it much harder to spot from the air, but you could still put a medium-sized helicopter down in it, meaning we’ll have access to full support. The LCVs will be on the perimeter, and the place is small enough so that, if the enemy tries to attack, the LCVs will have an overlapping field of fire; no blind spots. Some of you were in Rambia a year ago, and I don’t think you want that to happen again, do you? Now get to work. I want this camp ready in three days. Any day now, Nriv’Ka could be on the horn yelling at us to get the fuck into that jungle, because the Buchanians will attack. I agree with him. This valley is important. Whoever holds it holds everything for miles. We will not be to blame for screwing this up for the Generians.”
With a yell of approval, the soldiers marched to the clearing and began unpacking their extra gear from their backpacks, the exterior cargo pods of the LCVs, and from some of the boxes dropped from the plane along with them. The men all knew how to set up a small camp like this, and before sundown they had all their green camouflage tents up, along with a medic station, a radio tent, and Orlov’s headquarters. Dog tired, the men crawled into their sleeping bags and were asleep.
Some of the men wondered vaguely why a relatively high-ranking officer was chosen to lead this force. The answer was that Orlov was a better infantry commander in the jungle than most of his superiors were on clear ground, and he had an almost supernatural ability to sense the enemy’s next move, even when they were hidden by ten miles of trees. This jungle valley could well be one of the most important battles of the insurgency, Orlov had told his men. His leadership was sorely needed when this task force had to be able to react quicker than anything the enemy had. Orlov could direct his troops in perfect conjunction with his allies, but also alone, making the enemy wonder where he was even striking from. In the jungles of Rambia, the natives had been so confused by his ability to act independently from the other generals that they had no idea how to stop him. It was this campaign that had elevated Orlov to the rank of General.
At 0600 the next day, they were awakened by Orlov yelling at the top of his lungs. Nothing urgent, they knew by his tone of voice. They spent the day setting up barbed wire to reinforce the camp’s outer line of defense, setting trip wires outside the camp to warn of intruders, and fixing the Air Support Coordinator, or ASC, which had been knocked up a bit during the parachuting. All in all, though, they didn’t expect much of their machinery to break down, even in the jungle conditions. All of it was well made and durable. The ASC was especially important, because it allowed the camp to call in air support against an enemy target, and even use a remote laser targeting device to facilitate a pinpoint air strike.
The third day was spent mapping the immediate area around the camp, placing more small traps, these mostly for hunting rather than enemy deterrence, and learning how to best patrol the valley for the next few weeks. The 40th Army, they had heard, was moving through the mountains, and would take up a position on the Generian side of the valley. From their camp, the soldiers could see the mountains rising from the forest floor, only a mile distant. Nine miles the other way, they could see the Buchanian mountains. Orlov had informed them that he had received intel indicating that the BLA was similarly moving to their side of the valley, and would not give any ground to the approaching 40th.
Over the next few days, the men established a routine: get up, wash, eat breakfast, listen to the morning brief from General Orlov, get ready to patrol. There were four cells within the camp, and each had a time to send out patrols. The others drilled, hunted, and compiled the information that the scouts send back. Pairs of soldiers went out into the forest to learn about it, what plants they could eat, which animals were dangerous or easy to hunt. There were twenty five-man patrols, five from each of the four cells. All the patrols from one cell were in the jungle at one time, though separated from one another. The patrol was four hours for each cell. Cell 1 had from 0400 to 0900, Cell 2 from 0900 to 1400, Cell 3 from 1400 to 1900, and Cell 4 from 1900 to 0000. From midnight to four, the only men awake in the camp were the drivers and gunners of the LCV, who maintained their patrol during from nightfall to daybreak.
The routine was well established, and the men worked like clockwork, mapping the jungle more every day, and discovering which routes were easiest to take, where ambushes could be laid, and where men could hide, watching the enemy while staying out of sight. On certain days, one Cell would be given a long patrol, during which it would be out for eight hours, searching the far side of the valley. These long patrols happened only a week, and the Cell who was on duty for the long patrol rotated every time.
The camp was indeed running as well as it could in Orlov’s mind. He now had an accurate picture of most of the valley. Not a cut and clear satellite image, what most people thought of as an accurate map, but the information and maps his own men, veteran fighters, had drawn up for him. They were all good scouts, and like any good soldier, felt a natural desire to get to know their territory. If the enemy tried to move troops into this valley, they would find opposition from a determined, prepared, deadly, and most importantly, well-informed group of elite commandos. Orlov was quite satisfied indeed.
Generic empire
24-05-2005, 20:13
((OOC: Check the OOC thread for an OOC status update.))
Freudotopia
28-05-2005, 01:31
Gregor sat on his perch on the cliff, overlooking the valley below. The Lew Valley. He had never been here before, and yet now his people were predicting that its immense strategic importance would result in both the Generian 40th army and as many men as the BLA could muster converging on this forest, or jungle, or however you saw it.
Gregor spat, and watched it fall to the valley floor. One hundred feet below, it hit the ground with a splat, directly to the right of the rather serious-looking man in camouflage fatigues, carrying a weapon, like all four of the men with him.
Sgt. 1st Class Abram Nikoff whirled at the small sound. His eyes scanned the forest wildly, searching for a threat. He’d always been a cautious man, and the sound he’d just heard had sounded like a raindrop falling. And how the hell could it be raining if the sky was devoid of clouds? He hissed at his leader, Captain Jeremy Irloss, who was in charge of the patrol. “Cap! I heard a noise! Sounded like rain, but it can’t be raining now!”
Captain Irloss stopped his patrol with a raised fist. He removed a pair of binoculars from his pouch, and looked upwards. Through the trees he could barely make out a speck of green among the grey rock. Looking closer, he saw that it was a man, bearded, sitting on the ledge, his feet dangling. “Shit,” Irloss whispered. Keeping his eyes on the lone figure, he addressed Nikoff.
“Nikoff, get on the horn to base. I want to talk to the general now.”
“Sir, yes sir!”
Reaching for his field radio, Nikoff switched to two-way, which would make the signal harder to intercept, if anyone was listening. “Base, this is Patrol Four. Come in, Base.”
“This is Base, reading you loud and clear, is anything wrong?”
“Sir, possible enemy contact. Captain Irloss wants to speak to General Orlov ASAP.”
Nikoff heard a brief conversation, and a new voice came over the radio.
“This is Orlov. Report.”
“Sir, this is Nikoff, with patrol four. We have possible enemy contact. Captain Irloss wants to talk.”
Handing the radio to his officer, Nikoff grabbed his own binoculars and trained them upwards. He motioned for the rest of the patrol to remain still.
“General, this is Irloss. We have one enemy contact. No reinforcements in sight. Dressed in green camo. I think he’s BLA.”
“You would be right, Captain. I expected the advance scouts about now. This comes as no surprise to me.”
“Sir, should I order my team to engage? Reynolds could take him out with a long shot, or I could try to get my boys up to the cliff without him seeing.”
“Do not, I repeat, do not engage. Killing him would alert the enemy to our presence, and it’ll be too hard to scale that cliff. I want you to watch him, and alert the other patrols to be on the lookout for other BLA scouts. Tell them not to engage, unless they are spotted. Better to leave a corpse than a witness.”
“Yes sir. Irloss out.”
Handing the radio back to Nikoff, Irloss huddled his team together and explained the situation.
Five minutes later...
Captain Smathers, in charge of Patrol One, called his squad to a halt. He was not sure, but he thought he’d seen a flash of green between the rocks out of the corner of his eye. He paused, and waited. There it was again! This time he caught a clear glimpse of a man, running bent over to minimize his profile. He dropped to his knees behind a bush. His team, catching the movement as well, followed suit.
He turned to the man behind him, and whispered, “Dobrovsky, do you think you could get closer, maybe twenty meters, so you can get a good look at that guy?”
“Absolutely, sir.”
“Good. Off you go.”
Smathers watched Dobrovsky wriggle forward on his stomach, soon lost from sight in the thick underbrush. He kept his eyes peeled for the man, who he now thought was BLA. Abruptly his radio gave a tiny chirp and buzzed on his chest. Dropping even lower, he gave the signal for his team to keep lookout for the green-clad figure. He jabbed the receive button for two-way communication. A small, quiet voice came over the air.
“Smathers, this is Irloss. I’ve had contact with a solitary enemy soldier, green camo, likely BLA. There may be others. General Orlov says NOT to engage. Repeat, do not engage, unless you are spotted. You may observe, but do not be seen. Over.”
“Roger, Captain. As a matter of fact, I’ve got Dobrovsky observing one of the little fuckers now. Are we heading back to base once the enemy leaves?”
“On the double, but do not be seen. General Orlov stressed that. Irloss out.”
Dobrovsky slunk through the undergrowth, confident in his ability to stay hidden from what he thought was an enemy scout. Probably not as well trained as he had been, he reflected to himself. Situating himself between to leafy bushes, he peered out at the foot of the mountain, full of rocks and light shrub cover. There. He saw the man plainly. The other obviously had no indication he was being watched. Dobrovsky smirked. He could take this ignorant shit out right know, with no effort at all. He was only twenty meters away, at most. But he had his orders. Observe. As the scout turned around, apparently to check that no one had managed to find him, Dobrovsky got a good look at his face. Weathered and scarred, as though this man was either a career soldier or a man who had had his share of hard living. Probably both. A shock of dark hair, evidently thinning. Dobrovsky could see the BLA patch on the green camo suit. So, the enemy was indeed close. He wormed his way backward, and then started moving in the direction of his patrol. When he got back to base, Orlov would no doubt be interested in his findings.
–initializing cipher
–initialization complete
–sorting handshake protocols
–matching ciphers
–begin message
Nriv’ka:
My men have made contact with enemy scouts. BLA. I am preparing to begin mine-laying at once. You may take up positions along the mountains on the Generian side of the valley as soon as possible. I will supply mine-detection chips once you have established your position. The mines should slow down any initial enemy advances. We will continue to maintain our hold on as much of the valley floor as we can, but an all-out enemy attack will require reinforcements. We will be in radio contact, secure channel X8. You know the frequency and encryption scheme. Maps of the valley are being transferred along with this message. I believe the 40th will arrive shortly before the BLA, so you may have slightly more time to set up your defenses. Godspeed.
Orlov
--encrypting bodytext
--bodytext converted
--sending message
--message sent
--trace sweep running
--traces found: 0
--dropping line
Orlov walked out into the middle of the camp, and shouted.
“Mine-laying will commence tomorrow. Cells 1,2, and 3 will be placing and arming the mines, 4 will be back here managing helicopter deliveries. Get some sleep, men, because the 40th will be here in a few days, and the BLA not long after that. I want everyone alert and ready. Tomorrow’s activities will be crucial to the war effort here. That’s all.”
The soldiers smiled. They had always thought of Orlov as a quiet, unassuming genius of a soldier. You learn something new every day.
Freudotopia
28-05-2005, 23:36
Bumped this thread has been.
--Yoda
Shenyang
06-06-2005, 23:45
(OOC: Idea: future BLA contract to capture SCI informant, he surrenders, then my guys go in to get him back, huge battle ensues, you get the idea. I leave the decision to you GE)
The SCI agent had contacted Revenant, as was SCI custom, Revenant couldn't use the real name of his informant with anyone other than the agent's direct superior, and that was frowned upon, he was only cleared to know the informant's codename, Arbiter, a rather ironic name as he was disguised as a rather distant uncaring person, not an officer of the peace or judge. Those would have attracted too much attention, whereas a disillusioned veteran of the Shenyangi War of Liberation who happened to have a drinking problem, that wasn't very out of the ordinary anywhere, especially in a bar where he so often could be found. Many high-ranking BLA officers frequented this bar in a, "less-than desirable" part of the town, as a result Arbiter got a lot of information that would otherwise be very difficult to obtain.
Revenant met Arbiter in a park in the town, he was dressed in civilian clothes, even though he still had an air of military superiority about him. The fact that he had a SOCOM tucked into his belt didn't help with the disguise. At noon Revenant and Arbiter made their information drop after having a pleasent conversation, about current events, Revenant's family back in Shenyang, and the major battles of the Shenyangi War of Liberation, even though the both tried to keep the conversation impersonal then, as they both were supposed to be former soldiers who were disillusioned with war, when in reality both took great pride in their contribution to the war. Revenant having been a rifleman, and Arbiter, the medic responsible for saving his life, as a result, they both were very good friends, having depended on each other for survival many times.
This time he had information about the location of a weapons shipment, from the intelligence that he'd collected, it appeared that the destruction of this shipment would cause the BLA considerable aggravation and set them back millions of dollars. The shipment would be within striking range tommorow, until then the ODST were to stake out the road where it would pass, and attack the convoy as it passed.
Shenyang
07-06-2005, 21:11
It was around midnight, the ODST were hidden along an empty stretch of road, in the surrounding trees. They waited for the convoy to approach them, it was pitch black, but they'd kicked on their thermals and as a result could still see everything around them, in the distance they heard the sound of engines approaching. According to intelligence there were several 5 ton transports with jeep escorts. Taking a page out of the book of rebels everywhere the ODST had seeded the road with improvised anti-vehicle explosives, along with actual land mines and claymores. The convoy approached, coming around a corner in the road. Oblivious to the danger they were approaching. As the first truck reached the "point of no return" Revenant smiled in a dark satisfaction. Still the driver pressed forward, then suddenly, a large explosion rocked the air, and the lead truck turned into a somoldering wreck, the rest of the convoy, in shock, conyinued, and triggered more of the minefield in front of them, trucks burned everywhere as the convoy demolished itself, over the radio Revenant heard some of the men laughing.
The minefield destroyed, Revenant gave the order for the ODST to advance, and deal with whoever was left. They entered the filed of burning trucks, all around them they saw weapons crates, ammo boxes, fuel tanks, all blown out from the intense heat of the explosions. against all odds as they methodically cleared out each portion of their masterpiece of destruction they still found a few survivors, but they didn't last long, those who didn't die of their burns or shrapnel wounds begged the ODST to put them out of their misery, and out of respect for a dying man's last wishes obliged them with a quick end to their pain. As the teams reached the rear of the ruined, burning convoy they found something even more frightening, a pair of jeeps that had been bringing up the rear were waiting for them, as the jeeps opened fire the ODST dove for cover. They all reached cover, some later than others, two members of Sigma squad took hits which buried themselves in their legs, they would more than likely be fine, but the ODST couldn't afford all these minor casualties. Revenant, in a fit of blind rage at seeing his men hit, again, grabbed his M249 and dove into the open in front of the jeeps, he sprayed the area with fire, watching the gunners of the jeeps go down with a righteous anger. The other ODST opened fire as the gunners hit the ground, soon the jeeps were little more than burning hulks with bodies strewn around them. Revenant replaced his M249 over his shoulder and looked at the two men who'd been hit. He helped them up and back to the Humvees that they had stolen several weeks ago. There they were bandaged, and told to see the base medic once they returned to base.
Generic empire
11-06-2005, 06:04
OOC: Time for the Battle of the Lew Valley, which undoubtedly go down as one of the bloodiest conflicts in human history.
Generic empire
11-06-2005, 06:07
October 17th, 0500 hrs
Imperial 155mm guns roared and thundered, unleashing their fiery rage from every fortified Imperial position north of the Lew Valley. The screaming shells slammed into BLA positions on the mountaintops, and into the valley below, igniting large patches of forest. The glow could be seen from miles away against the velvet blue-black of the receding night, as the first fingers of the dawn stretched forth over the horizon.
General Vlakar Nriv’ka, the feared and brilliant military mind who commanded that instrument of death and destruction, the Imperial 40th army, lowered his black binoculars, his face set in his trademark scowl. He had demanded, against the protest of his subordinates, to be taken out into the field to observe the beginning of the operation that would make or break the Imperial war effort. From an Imperial fortified position atop a plateau, he listened to the deafening thunder of the guns and stared at the mouth of the Lew pass, the largest point of entry into the thick, nearly impassable, Lew Valley. Overhead, Imperial Generian GH-2s roared towards the plateaus and mountaintops where Freudotopian and Generian special forces had managed to secure a beachhead on the edge of the valley. Larger GH-41 transport carriers followed, artillery pieces, mobile SAM batteries, and armored vehicles dangling from ropes beneath them.
This had been the scene for most of the early morning. The Imperial army was indeed moving. Imperial armor had just hours ago began their drive to the edge of the valley, cutting through any remaining BLA forces in the Garrison-Lew stretch. Generian GIF-1s had been screeching overhead for days, bombing remaining BLA strongholds, and clearing the path for the 40th. But the battle for the Lew valley would not be won with tanks and numbers. Indeed, it would be a battle of air superiority, superior infantry tactics, and will. It would be a battle built on information and strategic targeting. It would be a battle of wits.
Nriv’ka saw this, and he was determined to prove the best at all of the above.
-----------
Lieutenant Vladimir Streteskyc watched the still green of the valley floor below him through the open side door of the GH-2 gunship. He let the heavy GIR-47 assault rifle rest in his lap as the heavy drone of the rotors beat his eardrums. His face was covered with thick green and brown camouflage paint, and his heavy dark green fatigues bore on the shoulder the insignia of the Imperial Black Guard, the deadly elite Imperial special forces unit. His team was being inserted on a plateau ridge a few miles into the valley. They were to make contact with and reinforce a Black Guard communications team that had set up there a few hours earlier. Contact had been sparse, and it was suspected that BLA elements had launched a counterattack to retake the plateau. Even this early into the fight, the BLA was digging their heels in. Streteskyc knew that the next few months were going to be the hardest of his career.
Towers of fuel-black smoke rising over the plateau supported the suspicions of the Imperial high command. A rocket-propelled grenade whizzing by the leading helicopter confirmed them.
“We’re coming in hot, lieutenant! Your men are gonna have to hit the ground running or we’re all cooked!”
The chopper lowered nose and altitude, and increased its speed towards the plateau. The communications antenna had been blown over on its side, and other makeshift structures were blazing. A fuel dump had also ignited, producing the heavy smoke that obscured the landing zone. Bodies of BLA fighters and Imperial soldiers became visible, but Streteskyc had no time to concentrate on the casualties below.
“Someone get on the goddamn machine gun!”
Streteskyc whirled around, and grabbed hold of the handle of the GMG-11. He swung the heavy machine gun towards the plateau as the helicopter whirled to reveal the plateau, and forced down the trigger to unleash a broadside of machine gun fire. The cannon spewed forth flame and hot lead at the enemy below, who retaliated with small arms fire.
“RPG!”
Streteskyc swung the cannon towards the kneeling figure with the long tube aimed directly at him. He fired, sawing off the man’s right leg, and sending his mangled form back two yards, blood spraying out over the rocks from severed arteries. Bullets ripped into the sides of the chopper above his head, and, gritting his teeth, he turned the cannon on a group of three fighters. A hail of lead ripped open the chest of one, metal searing into bone, fusing together. The man tried to scream, but there was no air to come forth, only a wave of blood gushing over his lower jaw. One had both forearms shredded, the AK-47 in his hands splintering. Red hot shrapnel from the gun shot up into his face, turning his eye sockets into blood gushing holes. The last man took a blast in the jaw, and the force of the clash sent him sprawling back, dead before he stopped rolling.
“Good shooting! We’re going in for a landing!”
A second GH-2 had joined the madness, and now was providing covering fire while the first spiraled down, hovering a few feet over the dusty surface of the plateau. Lew grabbed his GIR-47, and leapt out of the open door. He took aim at a BLA fighter covering behind a pile of metallic wreckage, and put a three round burst into his head and neck. The GH-2 lifted off as the rest of the Imperial soldiers scrambled to get cover, and the second helicopter moved in to deposit the rest of Steteskyc’s men.
A BLA warrior opened fire on the door to the GH-2 as a Generian Black Guardsman leapt out. The first burst hit the soldier in his chest and shoulder, the second in his legs. The Generian fell forwards onto the ground, his rifle still clutched in his hands. He struggled to return fire as his helmet detached and rolled over the ground. He landed a shot in the chest of his enemy, a young rebel clad in a hooded sweatshirt and a pair of worn blue jeans, but a stray bullet hit him square in the face, ending his own life. Lieutenant Streteskyc sprinted over the overturned antenna, and dived to cover as a burst of gunfire kicked up dust behind him. Overhead, the GH-2s whirled to unleash hell on the BLA fighters, who seemed to be appearing just as fast as they could be killed. Streteskyc raised his rifle to his shoulder and took aim at a group appearing from behind a burning wooden structure. He fired, cutting them down. From the corner of his eye he watched as a BLA man stood, and took aim at one of his men. The AK-47 burst cut another Black Guardsman down. Streteskyc retaliated, putting a round in the BLA man’s back.
Streteskyc’s radio on the chest of his uniform crackled.
“Fire team Delta-8, this is HQ, do you copy, over? Repeat, fire team Delta-8, this is-”
He put his back to the twisted metal, and depressed the radio call button.
“This is Delta-8! We have reached outpost-14 and engaged the enemy! We are encountering heavy resistance!”
“Copy, Delta-8. What is the status on the outpost?”
“Destroyed! Repeat, outpost-14 is destroyed! No visible survivors! We are under heavy fire!”
A white streak and the familiar hiss of a shoulder-launched surface to air missile heralded a brilliant explosion as a fireball engulfed one of the GH-2s, sending it falling to Earth like a broken model. The BLA forces had set up a portable heavy machine gun, and opened fire on a group of Generian soldiers. The head of a Black Guardsman exploded as he peered over to fire and was met with a hail of bullets. Another loud hiss, and the second GH-2 was engulfed in flame, spiraling to the ground. The burning wreckage buried a group of BLA fighters.
“We have lost the last GH-2! Repeat! Air support is gone! We can’t hold for much longer! Request additional fire support ASAP”
“Delta-8, we cannot provide additional support at this time. You are to hold your position, do you copy!”
“We cannot hold! We need air support!”
“Delta-8, hold your position until reinforcements arrive.”
The radio line went dead. Streteskyc cursed loudly over the sound of gunfire and explosions. He checked the clip on his GIR-47 and gritted his teeth. The BLA men were pouring over the edge of the ridge. He set up, and took aim, resolved to die fighting. He unloaded on the enemy, splitting heads and spattering clothes in thick red blood. His gun clicked dry and he pressed his back once more against cover. He pulled a grenade from where it hung on his vest, pulled the pin, and hurled it over the obstacle between him and the enemy bullets. The explosion was followed by screams. A severed hand and forearm landed in Streteskyc’s lap, a gold watch still on the wrist. The lieutenant cast the limb aside, and shoved a new magazine into his rifle. A fellow Generian slid over the ground and sat up beside him, wiping sweat from his brow.
“Streteskyc, am I fucking glad to see you! Bastards have us pinned!”
“No shit! HQ says we can’t get air support! We gotta hold here!”
“Fuck! Bastards are gonna murder us!”
“Just hang in there and do your fucking job, soldier. We’re not Black Guard for nothing.”
A dull thud brought both of their eyes to their feet, where a pineapple grenade lay in a small crater. As Streteskyc’s stared wide-eyed, the second man instinctively forced his body forward, onto the explosive. Streteskyc looked away, shielding his face. Warm sticky chunks of meat and fluid spattered across his arm and cheek to the sound of a muffled explosion. He looked back to see the mangled remains of the soldier, his face contorted into a grotesque expression, his abdominal cavity opened, and his intestines lying on the dirt. Fighting the instinct to vomit, the lieutenant looked away, and brought his rifle to his shoulder.
The BLA were moving forward, and soon enough, they would manage to flank the Generian positions. Then there would be no hope. They had to be pushed back. It was the only way to buy time for support to arrive. Streteskyc knew what had to be done. He looked to his right. A group of three soldiers were sheltering behind a sandbag barrier, leftover from the makeshift comms facility. He gestured to one, who passed the signal down the line. Streteskyc looked over the tangled mass of metal, and waited for a pause in the heavy machine gun fire. He held his palm out towards the man on his right. When the break came he gave the signal.
Streteskyc, along with the rest of the dozen men of the fireteam, leapt over the barriers, and with a mighty war cry, charged headlong for the BLA positions. The BLA were caught off guard. They recovered quickly, however, not before the Generian soldiers could cover the distance to their positions, and cut down a good number of them. Streteskyc leapt over a line of sandbags, and slammed the butt of his rifle into the face of a BLA fighter, sending him sprawling backwards. A second BLA man came at him from behind, but the burly Generian ducked and rammed his shoulder into the man’s abdomen, forcing him to the ground. He whirled again, and put a burst of lead into the abdomen of another guerilla fighter, doubling him over in bloody agony.
Freudotopia
11-06-2005, 06:09
His plan at first seemed to have worked. The BLA abandoned their hastily established machine gun positions, and began to fall back, but the tide had not yet turned. A crowd of reinforcements sent the BLA storming back towards their Generian enemies. Streteskyc whirled to find himself face to face with an enormous Buchianan charging him head on, bayonet glinting in the high noon sun. However, the grinning Slavic face disappeared in a shower of blood and skull fragments, to be replaced by one of a foreign officer, smirking as he lowered his rifle, a GIR-47F. Streteskyc recognized the gun, and grinned. Freudotopians. The officer, a lieutenant by his bars, spoke smoothly.
“Relax boys, the cavalry’s here.”
A unit of Freudotopian special forces had heard the firefight, and come up over the ridge to hit the BLA in the flank, cutting down large numbers of them, and sending them into a retreat.
“About fucking time.”
“Yes, well, we got held up by a particularly resilient crowd of the little fuckers down there in the valley.”
The Freudotopian gestured over his shoulder at the edge of the cliff, and the valley floor 100 meters below, obscured by the thick greenery of the forest.
There were a total of eight Generian Black Guardsman remaining after the encounter. The corpses far outnumbered the survivors, but the hill was theirs. Streteskyc shoulder his rifle, and walked over to the center of the plateau, trying to get a look at the retreating enemy, but they had already disappeared into the forest.
“They’ll be back.”
The Freudotopian officer appeared by his side.
“You can be sure of that, and in greater force. You see, they’ve put together a rather ingenious system of tunnels in the area.”
“Fuck. Why do I get the feeling it’s going to be our job to take those tunnels out?”
Generic empire
11-06-2005, 06:11
Streteskyc depressed the call button once more on his radio, and it crackled to life.
“HQ, this is fireteam Delta-8. Hill-14 is secure. The BLA has retreated, but I presume only temporarily. We’ve met up with a Freudotopian squad that informs us of a series of tunnels in the area. This is probably how the BLA are moving their troops here.”
“Copy, Delta-8. Additional forces are en route to reinforce your position. In the mean time, we need you to move forward and locate the entrance to these tunnels. Once you find them, we need you to blow them up.”
“Copy that. We’ll get on it.”
Freudotopia
11-06-2005, 06:27
OOC: I think I speak for all of us when I say that everyone, on both the Buchianan and Generian sides should get in the game, regardless of how active you've been in the thread before. We need some fresh blood. WAR!
Kroblexskij
11-06-2005, 11:31
Dear Maria
Today the battle of lew valley started, sorry i couldnt get a letter earlier, there was a huge secrurity thing, we thought some insurgents were going to attack the convoy, i knew it was rubbish, but some of the guys just went a bit OTT.
The general is listening to his damn 1812 overture again, keeps saying it reminds him of battle and sh*t. Everyone's saying its going to be the bloodiest since stalingrad.
You know as much as i do i may not return, but don't let that bother you or little sergey. Tell him his daddy is doing a special job for his firends and he will be back soon.
Da svidanya, bereg radnoy
Yasha
------------------------------------------------------------
Lew valley
[
"Move OUT
Go, go go"
The shout of the commander - firing into the mist and battle sword glinting with rocket flares.
Slavsya
The cries of the 4th RijksGuard Dragoon lowered the battle to a primeval gut renching bloodbath.
E E E E EAArCh.................
The Pre-landing rocket bombardment of the mountain-side cave kicked up the dust a bit more.
Ak Ak aka akakakaka
The heavy Gunship cannon riddled the defender "survivors".
Thump Thump Thump Thump
The sound of the 4th. Rijksguard Dragoon's boots hitting the bloodied floor.
A soft weeping
The sound of regret, regret from the blood bath.-----------------------------------------------------------------
BMP-2 07
The sound of metal clanking against metal, trundling, scratching, heating up barrels, cordite smoke.
Tank Ace Yakov Yashim drove his BMP-2 along the plateau, over the right he saw helis and the valley floor, over his left - the artillery and sighters, dug in bases with men running in and out like ants.
His job was to deliver his mech team to enforce a presence near the tunnel entrances, then support fire them and also mark out targets for helis to destroy with their heavy rockets.
He also had to look out for any hidden AA or AT positions.
“shit, I have a full plate.” He thought to himself, his mech squad were amusing themselves whilst sitting on top of the tank.
Yakov whipped out his binoculars as the convoy of trucks and jeeps, slowed down infront of him.
“holy Fu… INCOMING”
The giveaway vapour trail cut a line through the grey sky and past the Artillery posistion next to Tank Ace Yashim’s BMP.
Men were jumping off cars and trucks and taking cover by the ditches either side of the road.
The late Mr Yakov skerenstyl’ Yashim, so named after his grandfather the saviour of Stalingrad. Died sitting turned out of his vehicle. Only 5 of his men survived the other 6 died along with him.
The internal inquiry said –
BMP-2 commander Yakov Skerenstyl’ Yashim died at 4:07 AM whilst driving open topped in hostile conditions, endangering the lives of his men and ultimately ending another 4 of them.
He FAILED to ensure a formal tank,
CONCEDED to Following the order of a lesser rank – the order being to ride turned out through enemy territory.
ENDANGERED the lives of many.
FAILED his mission and has put the operation at RISK of failure.
Dishonourable Discharge With an Honourable Ace Funeral
His friends claimed this to be false and liable, an untrue representative of the Saviour of many.
In HIND 04
------------------------------------------------------------------
Crrrzz ---This is Heli 04 – BMP 07 is down – ending Bomb run now, will return to base for regrouping and re-brief, link up with GE forces En route – Over.
The Conflict Commissioner Looked down to his Nagant revolver and Battle katana - a present given to ranking officers of the Krob federal army- ceremonial aswell as practical, it serves a moral booster, to see a shining sword in the middle of a mud filled battle of death gives that final piece of courage needed in a time of darkness –
“I’ll use it tomorrow.” he kept telling himself.
“But today has been a neutral mission, we got here good, started good, ended bad, it’s going to be good tomorrow though.”
Tonight he was wishing to meet with generic empire leaders to decide a plan of battle. All this waiting was making him nervous.
Tommorow will be good, Tommorow will be good.
Shenyang
11-06-2005, 13:36
(continued form last post)
Polaris: Holy Sh*t!!! That shell nearly hit us!
Revenant: We'll make, its just another 5 miles to the fort. Stay calm.
Caldera: BLA roadblock ahead, sir!
Revenant: Fire at Will!
The ODST, still in their Hummers opened up on the BLA road block, still rolling toward the enemy, bullets ricocheted off the metal plates that had been hastilly thrown up on destroyed jeeps to make the roadblock.
Revenant: *firing weapon* Dammit Seraph! *firing weapon* Use the damned Javelin! *firing weapon*
Seraph: Yessir!
Seraph, in the number two Hummer grabbed the Javelin missile launcher stashed in the Hummer and trained it on the center of the roadblock.
Seraph: Everyone! DOWN!
Seraph fired the Javelin, the missile left the tube and hurtled toward the roadblock. It hit and detonated, blowing a sixteen foot hole in the hatilly erected roadblock. The Hummers formed into single file and floored it through the hole in the enemy defenses, as they passed a few men threw grenades from the last Hummer, enemy soldiers scattered as the high-explosive grenades went off. The ODST in the last Hummer continued to fire at the rear of the roadblock, porviding cover for their escape.
Revenant: That was different.
A shell detonated off to the right of the Hummers, they swerved due to the explosion but stayed on the road.
When the ODST finally reacheed Fort Lew and were admitted their Hummers were quite battered from the shelling of the valley. The ODST, apart form some minor scratches from flying debris however were fine.
Doomingsland
11-06-2005, 14:25
OOC:GE, should I start my big uber battle?
Freudotopia
14-06-2005, 00:25
OOC: Tunnels, GE! Tunnels! When?
OOC:Since you told me to....Also, FYI, STRACH is the Yaforite secret service.
BIC:
--------------------------------------------------------------------------
The Mouths of the Deska
--------------------------------------------------------------------------
It was a warm night, though not too warm. The mouth of the great Deska riverwas, however, hot, with water now much more like a swamp. Dragonflies buzzed around, clouds of them covering the area. Reeds poked their mouths out of the water, smiling up at the sun. Frogs churned up the mud, as they croaked, a loud, belching noise.
Two men strugled ashore, the reeds and mud catching their feet in a natural trap. The dragonflies, inquisitive insects that they were, moved closer to the men, like moths around a lamp. One man cursed, batting at the insects wih the flat of his calloused right hand.
"Shh!"" the other man said, fear carved like a state onto his face. "You know why we are here! It is not your business to talk!" The man whispered softly and quickly, his fear all too evident.
The other man ignored him. Raising his hand, he pulled out a large glass object in the shape of a hectangonal prism. It was large, with a dark top and bottom and in the fadin light, the second man coul not make out what it was. "What is it? oes it have anythign to do with the secret assignment given to you b-" The other man raise his finger to his lips. The second man shut up. It was clear who ranked higher here.
Drawing a box of matches from his pocket, the man deftly lit one alight with one hand. Opening the object, which the second man saw was a lantern, the first man lit it. He then moved the lantern in an odd pattern, pre-arranged, to show he was the correct man.
Over the hill, rebel soldiers waited for him to finish.
Off the coast, a boat waited, full of Five-Star STRACH agents.
Generic empire
20-06-2005, 19:47
-initiating tap trace…
-line clear
-beginning encryption process
-accessing cipher database
-randomizing pad
-encrypting level one…
-encrypting level two…
-encrypting level three…
-encryption complete
-transmitting files…
Sender: Colonel Josef Jaroslav
To: Colonel Marcus Crassus Gnaeus, Conflict Commissioner Hulikaya, Revenant, General Ivanov
General Nriv’ka, commander of the Imperial 40th Army in Buchiana, has decided that it is important he meet personally with each principle commander involved in operations here in Buchiana. At 8 O’Clock tonight, he asks that each recipient of this communiqué attend a special briefing at Fort Lew to discuss matters of strategy regarding the newly opened campaign of operations in the Lew Valley, a theater that he is certain will prove to be the backbone of our efforts here in Buchiana. Due to the hostile nature of the terrain, the Generian military will provide escorted helicopter transport to and from the meeting.
-Colonel Josef Jaroslav,
Imperial Generian 40th Army,
Base Commander, Fort Lew
-initiating tap trace
-line clear
-erasing cipher pad
-terminating transmission
-terminating line set 1
-terminating line set 2
-terminating line set 3
-transmission terminated-
----------------------------
The one thing I learned from Buchiana is don’t go to Buchiana.
-Anonymous Generian Soldier
Lieutenant Vladimir Streteskyc looked down the steep and rocky slope at the valley floor, 100 feet below. A stone slipped from under his heavy leather boot, and careened over the cliff. A young officer standing beside him spat over the edge.
“What a fuck hole to have to fight a war in.”
Streteskyc didn’t respond, turning away and walking over to the Freudian officer.
“Ready?”
The man looked down the worn path leading over the plateau, eventually winding its way down into the trees and the forest floor.
“I suppose as much as I’ll ever be.”
The Generian lieutenant looked back at his men, eight of them left standing after the battle with the BLA militia.
“Sergeant Serenjano, form your men up. We’re moving out.”
A grizzled old soldier saluted from where he sat on an overturned jeep, grinning as he clenched a fat cigar between his teeth.
“You heard the man! Off yer lazy asses!”
Grumbling, the men got up and gathered their weapons and equipment, walking over to where Streteskyc and the Freudians were waiting. Wordlessly, they started off down the silent path into the jungle.
Shenyang
21-06-2005, 20:06
Out of boredom Revenant looked at his watch, realizing it was 8:12 he groaned to himself.
"Ahhg. I've got to go to that meeting."
He rose from the desk where he'd been sitting, checked the gear he had on him. (his katanas, and Mk. 23 SOCOM) He began walking to the command bunker. Along the way he stopped to check with Polaris, his second-in-command for a short chat.
Revenant: Hey, whats up.
Polaris: Nothing much, I've been doing laps out here for the past three hours.
Revenant: Really, in full gear, I'm impressed. Anything interesting happen lately?
Polaris: No... Patriarch took off for some manuevers about an hour ago, Looked like they were prepared for a trouble. They had rocket pods and Hellfires, so they'll be fine, but still, going on manuevers in the middle of a war seems risky. What do you think?
Revenant: Yeah, seems a little bit out of character for Patriarch to do that, then again, this is as good a place as any to train, live fire plus shit loads of allies around if you're shot down. Anything else?
Polaris: Yeah, all day armored vehicles have been showing up all day. Looks like a full assault force.
Revenant: Yeah, we're starting the battle for this god forsaken valley, there's a meeting for force leaders that I'm late for. They proably are waiting for me to get there, so I've got to be going.
Polaris: See you later, Revenant.
Revenant: Seeya.
Revenant slowly began to walk toward the command bunker. Polaris began running again. Revenant sauntered along ewnjoying the sounds around him. Weapons fire could be heard coming from the valley ahead, and it calmed him, as battle always did. As he entered the bunker he felt several eyes fell on him. He took a seat and waited for the meeting to begin, as several leaders appeared to be absent. As he waited Revenant began checking his SOCOM. He checked the sights, they looked good, though he'd have to fire to be sure. The action slid smoothly, except one spot, which he promptly checked, a piece of shrapnel was lodged in the slide. Revenant removed the shrapnel and checked again, this time the slide moved perfectly. The barrel was clean, he reloaded the two rounds he'd ejected and waited.
Generic empire
26-06-2005, 02:15
-initiating tap trace…
-line clear
-beginning encryption process
-accessing cipher database
-randomizing pad
-encrypting level one…
-encrypting level two…
-encrypting level three…
-encryption complete
-transmitting…
Sender: General Vlakar Nriv’ka
To: Colonel Marcus Crassus Gnaeus
Colonel, there’s been a change of plans. We’ve just picked up intelligence relating to the location of a meeting between a pair of high priority targets. One of GIIS’s informants has suggested that one Dmitri Dvinov, a man suspected of directing BLA information and electronic warfare projects for upwards of five years, was as of twenty minutes ago en route to a BLA stronghold to meet with General Dimka Morosovic, a ranking BLA high commander believed to have been in direct contact with one or both of the Mareki’ev brothers. We need you to capture both alive. The installation has been identified as a communications outpost situated on top of the plateau.
The facility is also of some strategic importance, so after you take down the targets, you’ll have to hold the hill until Generian reinforcements can arrive to take over. Due to the nature of the meeting, the area will be heavily fortified. General Morosovic will no doubt have his personal elite contingent of special forces protecting the place, and I wouldn’t be surprised if there were some mobile SAM batteries running around in there. It won’t be easy, but I have utmost faith in you. Keep it fast and simple, and I trust your men will come out for the better.
-initiating tap trace
-line clear
-erasing cipher pad
-terminating transmission
-terminating line set 1
-terminating line set 2
-terminating line set 3
-transmission terminated-
Doomingsland
26-06-2005, 02:41
Reclining back in his cheap metal folding chair, Marcus stared at his laptop screen for a few minutes, reading over the message he'd just recieved. He sat in a small, simple tent, a wooden bunk off to the side with a metal locker containing his armor and personal weapons, and a trunk containing what few personal items he possessed. He considered what little he had to be too much as it is. He liked to travel light. He wore black camo fatigues, a .45 hanging off of his belt. He personally didn't like these non-lethal ops, but whatever his Generian hosts wanted...
Stepping out of his tent, he yelled for Lieutenant Kaeso Meridius to come.
Meridius, a man in his early thirties, looked ancient. His hair was already greying, and his eyes betrayed wisdom far beyond his age. He was a soft spoken yet stern man.
"What can I do for you, sir?" he asked pleasently.
"Kaeso, intell just came in on some high level BLA informant meeting with a general at a known enemy stronghold." said the colonel bluntly. It had the desired effect. They'd never gotten the chance to take down someone of such a high rank in this theatre.
"You wish for me to kill them, sir?" asked Kaeso in the same pleasent tone.
"Negative, Lieutenant. We want them both alive. And be subtle about it."
This caused a frown to come across the face of the lieutenant.
"As you wish sir. I depart now in the name of the Emperor." he said seriously. As if robotically, the Colonel replied,
"Strength and Honor, my brother. Go now."
Walking back to the fire he and his team had camped around, he explained the situation. They were most eager, having been bored out of their minds for the past month or so. It also gave them the chance to play with some new toys they'd been issued: the M-91A1 submachine gun and an attached non-lethal munitions delivery system.
Pulling on his armor and slapping on his Roman-esque helmet, Kaeso picked up his SMG off of the wooden bench the men had been sitting on and slung it over his shoulder. Heading towards the awaiting MV-68, he decided he had a bad feeling about this mission...
--------------------------------------------------------------------------
Amidst the dim red light that illuminated the troop compartment of the Banshee transport VTOL, Kaeso looked slowly at the other three men that made up his team, designated "Chalk One" for this op. Their visors concealed their scarred faces, cut and mutilated during their brutal training excersises. These men were green: they'd never seen real combat in Bucchiana. However, that wasn't to say they'd never seen real combat. They'd all been through hell back in that frozen wastland the locals call "Alberia"...
As the HUD began to indicate the transport's rapid approach onto the LZ, Kaeso stood, grabbing onto the rail that addorned the cieling.
"LZ looks quiet, ETA thirty seconds!" yelled Sergeant Titus Afranius, the pilot of Super-Six One.
The hydrolics of the ramp door began to croon, and the door inched open, revealing the quiet, darkened town below them. Fresh air instantly shot into the compartment from the outside. The men had gotten used to such a sensation from hundreds of insertions, so no one was surprised when they were hit by such force.
Watching from who-knows how many miles away, Colonel Gnaeus and his command staff casualy watched the LCD sceens, one for each of the four infantrymen and two for the transport. The aircraft quietly hovered over the roof of the target building, and the men dropped down, landing softly as dust from the ground kicked up by the aircraft's engines filled the air. It was twighlight, so the men had just enough light to see, yet it was dark enough for the aircraft to infiltrate. Upon their successful insertion, Super-Six One's engines vectored back into position, and she climbed to an altitude of ten-thousand feet to orbit the target area.
Shouldering his weapon and aiming it towards the door, Kaeso motioned for one of the men to open it. Finding it unlocked when he tried the handle, he stepped out of the way and threw it open. Kaeso immediatly rushed into the small stairwell. They found one flight of iron stairs in a brick chamber leading downwards.
The men catiously moved down, their weapons trained at a door at the bottom of the steps. Upon reaching it, Kaeso withdrew a small fiber optic camera and snaked it under the door. The scene through the camera's lense was projected directly onto his HUD: two gaurds, one asleep in a metal chair by the door closest to them, the second leaning against the wall on the other side of that same door taking a drag of his cigarette.
Signaling to his men what he saw, he stood up, assuming the same position he'd taken up last time in front of the door, his weapon shouldered and aimed towards the approximate area of his target's head, but this time had drawn his Long Knife, holding it in his left hand while his right sat firmly on the pistol grip of his weapon, his left forearm supporting the weapon.
As before, his comrade ever so quietly threw open the door. Kaeso quickly adjusted his aim, putting the red dot reticle of his submachine gun directly over the head of the man smoking the cigarette. Gently tapping the trigger, the weapon recoiled against his shoulder as a single silenced round shot out, hitting the man squarely in the temple, blowing the other side of his head out and spilling blood and grey matter all over the wall and floor. The man who had, until Kaeso had taken the shot, been asleep looked up at this new threat, his eyes wide with terror. The Legionary quickly lunged at his surprised foe, catching him in the throat with a back-handed slash with his knife, and put his right hand over his mouth to keep him from screaming, letting his gun slump down to his chest and hang from the strap. Blood had been spattered all over his visor, and he moved his arm to wipe it off, staining his black uniform. As his victim went limp, Kaeso wiped the blood from his blade and sheathed it, gripping his gun once more, tucking it tightly against his shoulder.
No one had heard the ruckuss, thankfully, and the men were able to move on about their bloody buisiness.
Moving up and crouching in front of the door the fallen rebels had been guarding, Kaeso once again withdrew his trusty optic cable and slipped it beneath the door. They'd already heard voices coming from the other side, and figured that this room, being guarded, was their target area. They guessed right. The image projected on their HUDs showed several rag-tag men in camo fatigues sitting around a table adorned with maps and coffee mugs within a cigar-smoke filled room. Their targets were in plain sight, sitting across the rectangular table from one another. As he moved the cable back and forth, scanning the room, he found two pairs of legs standing to either side of the door.
Damn, they're thourough... thought Afranius to himself as he withdrew the cable from the crack beneath the door, tucking it back into a pocket.
Motioning for the men to prepare to breach the door, one of the Legionaries reached into a pocket and removed a small charge.
Kroblexskij
26-06-2005, 12:42
On the Nogalstic
Commissioner Hulikaya
Da
A meeting was requested with the Commander Nriv'ka at fort Lew , 2000 hours. He said there wi....
---The screech of a TR-17s taking off from the deck interupted all that was going on and startled the radio operator.---
HE SAID THERE WILL BE A HELICOPTER ESCORT.
DA, YAH, I'LL TAKE ONE OF THE HELIXs.
RADIO THEM TO SEND THE HELI CONVOY TO THE ENCLOSED COORDINATES, THEY WILL LAND ON DECK AND ESCORT ME TO THE BASE.
---The commissioner stepped onto the observation post to watch the coastline miles away, as the operator ran back to the bridge.---
---He pulled out his binos and scanned the cold, wet, dark, unforgiving horizon---
Generic empire
01-07-2005, 05:36
Briefing Room, Fort Lew
A few minutes after the various COs were ushered into the bunker beneath Fort Lew that housed the 40th Army military command briefing and operational planning center, General Nriv’ka himself entered, and stood before the other assembled parties, in front of a large illuminated map of the theater.
“Gentlemen, I apologize for pulling you away from your commands on short notice, but I have concluded that it is best I lay out the situation to you in person. As you know, today the 40th Army began the assault on the Lew Valley, the primary longstanding holdout of the BLA and their elements in the province, and the definite staging area for any future operations into the northern province. Thus it is imperative that we wrench this piece of territory from BLA control at all costs, and clean out any and all rebellious elements to secure it for Imperial use. The Lew Valley commands the only major highway into the southern province, making it a key strategic objective if we intend to move heavy equipment for the assault on the BLA strongholds of the south.
However, as it is late in the year, and the winter in Buchiana is notoriously bitter, we will not be able to make use of this road during the campaign in the Lew Valley until spring, as the BLA has taken steps to block the road, and it will be nearly impossible to clear it with the cover of snow, ice, and mud. Therefore, I can safely say this battle will be won by our infantry and our air forces, which is why you are here.
My overarching strategy in this campaign is one of island hopping. If we can control the high ground, we can force the BLA onto the forest floor, and eliminate them with air power. However, I will be asking you at times to send your men into the valley to retrieve key targets and secure objectives. You will have to adapt to beat the guerillas at their own game.”
A large screen behind him flicked on, displaying the picture of a grim looking man with a grey beard clad in camo fatigues.
“This is Rostislav Mareki’ev, the BLA director of operations in the Valley, and the brother of Nikolai Mareki’ev, the most influential of the BLA commanders. His capture will be foremost on our list of objectives. It is imperative that his location be discerned, and his escape prevented. It is a near certainty that he knows the location of Nikolai, and thus his position at the top of our target list will be static throughout the campaign until his capture. I will be entrusting you to be acting as my eyes and ears. If your men discover information that could lead to this man’s capture, or that of one of his close associates, you must relay it to me immediately. Generian Military Intelligence is going to be working side by side in the field; expect to hear from them. However, GIIS has been acting strangely these days. There is word of internal strife and mole activity in the upper echelons, and I do not know who I can tell you to trust, so I will be frank and tell you not to trust GIIS at all. I ask that you relay any and all communiqués from the spooks to me. I cannot have my operation compromised by internal spy wars.
That is all gentlemen. You realize the importance of this campaign, and I trust you will command your soldiers honorably and effectively. In a few days, expect word from Colonel Jaroslav with information on your operations. We have established a new firebase in the hills over the valley. You will be operating out of there from now on. Firebase Viper is the designation, but don’t expect a warm welcome. The BLA aren’t going to leave such a presence alone for long.”
Shenyang
01-07-2005, 15:05
Revenant having patiently listened to the briefing decided he might as well tell General Nriv'ka about his spy. He waited for the other COs to clear out and approached the General.
Revenant: General, this may be a shock, but SCI has a man here in Buchiana, as we consider any terrorist or revolutionary activity a threat they deemed it necessary to send an operative, without informing anyone in your country ahead of time, "plausible deniability" issues or something like that. I can't give you any more information than that, but I was wondering, do you want me to pass along any reports I get from him too? 'Cuz I've got no problem with that, I would get you his dossier, but, well, you know its all quadruple classified, top secret, need to know stuff and getting anyone outside Shenyang clearance to see that is like, well, damn near impossible. Hell, the only reason I know is because I'm a Brigadier General, otherwise I wouldn't even know about the guy. Still, gimme the word if you want his reports.
Kroblexskij
01-07-2005, 16:30
After the Meeting
"Great , This is just what we need"
---The commissioner walked out of the meeting rubbing his hands together.---
"I have the perfect force for this job,
An airborne, set of troops , used to the cold and with heavy backup firepower to bring down those emplacements."
---The helicopter outside the complex started up its engines just as he appeared from the door. He stepped up and strapped on the belt for take off as the Navy sentrys, guarding him, jumped through the back door and into thier seats.
The Ground crew gave the all clear and the copter whisked off into the night sky. The landing lights blinked off to hide thier presense as they flew over dangerous territory
Generic empire
01-07-2005, 20:06
Nr'iev nodded as Revenanet laid down his explanation.
"You can take comfort in the fact that you aren't alone. There are bound to be dozens of agencies with men on the ground, and knowing GIIS, they're bound to know about your boy already. If you can, get me his reports. They could be useful to the war effort."
Generic empire
01-07-2005, 20:16
Streteskyc had taken point as they moved down the narrow trail. His eyes, unused to the dark and the endless green of the jungle-like Lew Valley forest, began to strain as everything seemed to meld together into an endless veil. He doubted he’d be able to spot any form of Buchianan ambush or trap until it was too late. Raising his hand, he stopped for a moment to allow himself to readjust. He raised the GIR-47 as he scanned the gloom ahead for any signs of movement, or an entrance to the tunnel they had been sent to find.
Overhead, the whir of a helicopter engine told him that Generian soldiers had arrived to take over control of the plateau he had been ordered to abandon in preference of this wild goose chase. He looked back to see the Freudotopian lieutenant swatting at some winged insect, most likely the last of the species this late into the winter. Pressing the butt of the GIR-47 snugly against his shoulder, he continued forward, the rest of the team following.
“He felt himself hitting the ground before he realized what was happening. One minute he had been walking along as before, and the next, he was face down in the dirt, a sharp pain running through his ankle. Instinctively, he looked up and raised his rifle to scan for threats, but found nothing. Rolling over onto his back, he saw the Freudotopian leaning over, examining something in the middle of the path.
“You should be on your knees thanking the good Lord right now, not on your back.”
The officer looked over at the Generian and held up a loose wire, the pin of a grenade attached to one end.
“If the bastards had acquired that grenade from a more reputable source, you might be missing a leg right now.”
Streteskyc sat up, and then got to his feet, wincing almost imperceptibly as he put weight on his ankle, sprained in the fall.
“Come on. We’ve got to find this thing before it gets dark or we’re up shit creek.”
Streteskyc turned and continued into the jungle, the rest following him.
Freudotopia
03-07-2005, 01:39
Sergeant Major Nikko Kosyov inched his way forward, his belly scraping the twigs and leaves of the jungle floor. His patrol, in similar uncomfortable positions, followed closely behind. No one complained; that was against regulations, but still he could feel that no one really wanted to be here.
“Here” was the floor of the Lew Valley, miles of jungle in every direction, and the constant chatter of machine-gun fire mingling with the pounding of mortars to create a rather noisy working environment. Kosyov and his patrol had been sent to rescue a group of Generian soldiers from overwhelming enemy forces. They had escaped, but sustained several casualties in the process. The other side got the worst of it, though, and Kosyov felt reasonably sure that they wouldn’t be back for more anytime soon.
“Sergeant Pepper, get those three back there up with the rest of us. I want no stragglers.”
“Right away, Sarge.”
Kosyov knew that he had to keep his patrol close, or the wild animals would pick them off. There were jaguars in here big enough to eat your head off, and a complement of poisonous snakes that was even more dangerous for being next to invisible. The Generians were tiring, too. Their rigid training had allowed them to last far longer than normal soldiers would have after seven straight hours of fighting, but Kosyov could tell that they were nearing exhaustion. He decided to call a halt to rest his men for a short while. He knew that it wouldn’t be long before they’d have to be on the move again. There were only a few precious hours of daylight left; once the sun sank behind the mountains, the only option was to dig foxholes and wait out the night. The problem was that if they had to dig in, they’d be set upon by the animals and the enemy. The only option was to find the tunnels.
“Halt! Take a ten-minute break, but keep your eyes peeled. Henderson!”
“Yes, sir.”
“Take Zirmov and scout ahead. Go about a hundred yards, then report back.”
“Yes, sir.”
The two men moved off into the jungle, and were soon lost from sight. Ten minutes passed. No sign of the two scouts. Kosyov decided to wait another five minutes, and then go look for the two. He hadn’t heard any gunfire, which meant that the scouts were probably stuck or lost. Either way, they couldn’t be in too much trouble.
Five more minutes ticked by. The two scouts were nowhere to be found. Kosyov knew he had to move out.
“Attention! Everyone get up and gear up, we’re moving out!”
The patrol started off again, as one this time, with Freudians and Generian mixing. That could pose a slight problem, as the two groups had never done any combined drills, and their fighting styles were decidedly different. Generians, armed with the powerful GIR-47, tended to annihilate all opposition as quickly as possible, regardless of their own safety. Freudians found cover and picked off the foe with their GIR-47f rifles, which traded stopping power for increased accuracy. A bullet to the chest or head would still kill a man, but it wouldn’t pierce wood, metal, or advanced body armor like the GIR-47 could. Consequently, the Generian foot soldiers reflected the style of their armies as a whole: large, powerful, and unapologetically heavy-handed. They would raze an entire village to kill one enemy informant. The Freudians were more subtle, relying on tactics and maneuverability to win the day. Enemies trying to fight back with guerilla tactics were frustrated by the ease with which the Freudians could evade them. Together, the two styles complemented each other perfectly, and Generian/Freudian combinations were especially lethal.
Thus, Kosyov felt fairly confident that he would indeed find the tunnels he was looking for. Airborne reconnaissance had indicated that the entrance to the tunnels was a small concrete structure somewhere in this vicinity. The fact that two men were missing was just a small wrinkle, soon to be ironed out. He thought.
The two patrols kept moving as one, cutting through the jungle quickly and efficiently, every sense alert to signs of trouble. Kosyov was in the middle of the group of 31 soldiers when the advance guard entered a clearing. Knowing that an ambush would be most likely to be mounted here, he glanced around. Suddenly, Kosyov heard a gasp from the front. Then he saw the glint of metal.
“Shit! Cover!” Kosyov screamed. But there was none. Grass and small bushes were the only growth in this partial clearing. He dropped to the ground, he rifle swinging toward the enemy, but even as he did so, he realized it was a futile gesture. No fewer than fifty BLA had surrounded the clearing, armed with outdated Kalashnikovs and a few FR-110s, a cheap but powerful rifle mass produced in Freudotopia and common in the armies of less-developed countries. Fifty rifles were trained on the Freudian and Generian troops before they could bat an eyelash.
“Put down your weapons, scum! I am Sergeant Olaf of the BLA, and I declare you to be prisoners of the Independent Buchianan Military! Resist and you will be shot.”
A tall Buchianan with a red beret stained with muck was shouting from the brush. His men were standing, walking forward a few steps, their guns still pointed at the patrol.
“Keep cool, chaps,” Kosyov announced.”
Olaf shouted, “Keep cool! Do you hear that, my comrades? He thinks they will leave this place alive. Oh, I’m afraid he is much mistaken. Am I right?”
A chorus of mocking laughter greeted this pronouncement. Meanwhile, Kosyov reached down to his belt and unclipped a small silver cylinder with a red button on one end. He concealed the device in his palm, and turned to the Buchianan once more.
“Listen to me, you sorry excuse for a soldier. Before this day is done, you and all your men will be dead, your tunnels will be collapsed, and me and my men will be safe at our bases, sipping a cool brandy and reflecting on your poor fortune.”
Olaf’s face darkened, and he pointed his rifle straight at Kosyov’s forehead.
“You are insolent, Freudian dog. It is you who will die today. Goodbye.”
Kosyov pressed the red button, and a wave of fire flashed around the edges of the clearing, engulfing the Buchianan troops. His men dived for their weapons, firing into the woods. The Generians, caught slightly by surprise, followed their lead and began to fire their own weapons. Out of the corner of his eye, Kosyov could see Streteskyc pumping rounds into the space where Olaf had been standing just a second before.
After a few seconds of continued fire, the smoke from the explosion cleared, and the Freudian and Generian soldiers saw that it was useless to fire any more. All of the Buchianans lay dead, most killed by the initial blast.
Streteskyc walked up to Kosyov, his rifle held loosely by his side.
“Holy shit,” he whispered, “what in Christ’s name was that?”
“Quite the conflagration, wasn’t it?”
“You could put it that way.”
“That, my friend, was the favorable result of the extensive mine-laying efforts of my comrades before the battle began. Thousands of P I D M24 mines were placed in this jungle. Including in this clearing and the surrounding woods.”
“What in the Hell is a PID, and how are we not dead right now?”
“PID. stands for Personnel Incinerating Device, an anti-troop mine developed shortly after the Ismerian War. In the thick jungles, we learned that fragmentation explosives were less effective, and tended to ricochet off of trees and such. Thus, the PID is primarily an incendiary explosive device which creates a powerful explosion and initial shockwave upon detonation, and sprays fire in every direction. No dangerous shrapnel, and plenty of unfriendly casualties. The weapon was designed by General Orlov, and I must say, it’s quite an impressive result.”
“That still doesn’t answer why we’re alive and they’re...nothing at all.”
“Well, that’s just the ingenious part of the M24's design. Instead of being pressure sensitive, they’re remote triggered. Every officer has a detonator. Extremely high frequency, short range. It creates a ‘doughnut effect,’ meaning that a certain radius extending away from the detonator is untouched, but then an area beyond that is destroyed, along with anyone unfortunate enough to get in the way.”
“Amazing. My government will want to get a few million of those as soon as possible.”
“Absolutely, old boy.”
“But I have one suggestion to make, one that your field engineers might be able to implement.”
“What’s that?”
“You might add some sort of control to fine-tune the area affected by the blast, and the area in the doughnut zone. I think we were lucky today.”
“We were indeed. The Buchianans unknowingly put themselves in the worst possible position, twenty meters from the detonator, roughly speaking, but well within the range of the signal. The results were predictable.”
“Well, it was good thinking on your part. Should we move along?”
“At your leisure, Streteskyc. I think that’s the last large group of BLA in this area. I expect there will be more in the tunnels, though.”
“Then we should get to those tunnels ASAP. Let’s go.”
The two leaders barked out orders, and the two patrols moved into the jungle once again, leaving a patch of flaming underbrush behind them. The nightly rainfall would quench the flames, leaving the rest of the forest intact.
A half-hour later, the group arrived at a small concrete pillbox sunk into the ground, the jungle branches and creepers cut back for the moment, but already starting to regrow.
Kosyov turned to Streteskyc, and with a cheerful smile, beckoned him inside.
Shenyang
03-07-2005, 16:05
About 20 miles outside Fort Lew, approximately 3:00:
The ODST were slowly advancing toward the target area, a large field that intelligence suspected was being used as a communications relay due to the shack in the center which was covered in satellite dishes. It was cold, but nothing like what the ODST were used to, for this operation only the Squad Alpha had been sent, they needed to keep their impact minimal during this assault, otherwise they'd be knee deep in BLA soldiers, which, while a nice bit of fun, would not be the best thing for their operations in the area. The underbrush presented little problem to the soldiers as they made their way to the field. Part of their training was that they had to be proficient in survival and covert operations in any theater. As a result they knew exactly what they were doing. Ahead they heard the sound of a BLA sentry, intelligence indicated that only the leaders of a patrol called in unless there was something to report, and one look at the man ahead indicated he wasn't going to be leading any patrols.
He didn't have a radio for one, and he appeared to not be taking his job too seriously. Revenant gave a short series of hand signals, the men understood immediately. They all began holding position, except for Revenant and Polaris. Polaris began sneaking around toward the front of sentry, Revenant the back. Silently Revenant took out his garotte wire and advanced, sure that his equipment would not make a noise. He got within striking range, about two feet and Polaris made his move; he stepped out of the brush and surprised the sentry with a quick wave and a smile. The man recoiled in surprise and revenant looped the wire around his throat, with a quick move and a few moments the man was down, for good. Revenant unlooped his garotte wire and put it back in the pocket he'd taken it from. He gave a quick whistle and the rest of the squad began following again. Polaris hid the body in the underbrush where he'd emerged, He then joined the line and they continued. From the body he'd taken a card key which would give them access to the hut without the use of explosives, which he thought to himself sort of ruined the fun, but that wouldn't matter, there'd be plenty of shooting, and a very nice explosion at the end so he ramained happy. As they continued they found something that put a damper on their contentness, a minefield.
(OOC: All dialog is in a dialect of Shenyangi that hasn't been used for over a century, so no one can understand what they are saying to when they speak)
Revenant: Beautiful, we need to get through this to reach the objective... Caldera, this is your specialty right?
Caldera: Yessir.
Revenant: What do you think, can we cross?
Caldera stepped forward and hunched over examining the minefield.
Caldera: One second... evenly spaced mines, Bouncing Betties, nice choice, tripwires out the ass, laid out in a tight grid, about... one and a half, I'm impressed, a professional job for sure...
Revenant: I'm glad you appreciate the f***ing craftsmanship, but if you don't give me an answer about whether we can cross without getting blown to hell I'm going to clear a path myself with a few of these.
Revenant began tossing a grenade up and down in his right hand.
Caldera: Uh... yeah we can cross, about ten feet down there, they couldn't plant mines on the roots of those trees, we can just walk over the roots, no problem.
Revenant: Good. You take point in case they've got some explosive surprise on the other side for us.
Caldera: Yessir.
The squad made its way over the roots, there was nothing on the other side and Revenant took point again. Approaching the clearing they encountered another guard, however he was definitely alert, and they wouldn't be able to sneak up on him, so with a nod from Revenant Polaris unsheathed a throwing knife from his vest and lined up the sentry. He threw the knife. It tumbled through the air and connected with the man's throat. He fell silently. As they passed Polaris grabbed his knife. Caldera hid the body in the brush and the squad moved to the edge of the clearing.
With another series of hand signals Revenant gave the next set of orders. Fireteam One would advance to the hut, and Fireteam Two would hold position and provide sniper and light anti-armor support form the edge of the woods. Fireteam One prepared to advance and Polaris handed over the card key to Revenant. Pocketing it Revenant gave the signal for his men to silence their weapons followed by the order to drop into a crawl. Silently and slowly they advanced across the field, checking in front of them for mines. Reaching the edge of the mowed are the fireteam held at a whistle from Revenant. About thirty feet away was the hut, inside could be heard the sounds of people typing and talking. To the right a jeep could be seen near the entrance of the hut. It was unguarded, like the hut itself. Revenant whistled again and the fireteam advanced into the open and transitioned to a crouch. Following Revenant they moved toward the jeep. Revenant ducked under the jeep, and unsheathed his combat knife. He gave a quick look left and right to make sure it was clear and punctured the fuel tank. Then he slit the brake cables to be sure that even if the jeep got the going it wasn’t stopping. He sheathed his knifed and slid out from under the jeep. At a hand signal the Fireteam had taken up positions on either side of the door. Revenant gave a nod, slid the keycard and opened the door silently Caldera entered first, securing his point of domination as the rest of the team entered the room was secured further and further until it was obvious that if anyone was in the room with them he or she was invisible.
Down the hall on the right was the security control room, on the left was the armory, beyond the armory was a bathroom and at the end, the communications room. Revenant gave the signal to split, half the team would secure the armory and the other half the security room. The door to the security room was glass, as was the armory door. The rooms appeared to be sound proofed, probably to try to block the sound of the transmissions running through the facility from getting out of the hut. Revenant counted down with his fingers from three. When the last finger fell he and Caldera opened their doors and their partners each threw in a flashbang. In concert the men inside were stunned, the sound not escaping the rooms. Entering the rooms Each group detained those they had stunned. Binding their hands and feet and knocking them unconscious with the butts of their weapons. Revenant who had taken the control room looked at the video surveillance console, a camera in the communications room, the entrance and the armory, which he thought was pointless since the armory was right across the hall. Looking into the armory Revenant saw Caldera placing C4 charges in places where they would not be noticed. Such as behind drawers and above the gun racks. He set eight charges, a little wasteful, since each weighed around two pounds, but it would make one hell of an explosion.
Exiting the security room Revenant and his partner moved to secure the bathroom, which had a solid door for obvious reasons. It was empty, and they decided it would be best not to set any charges here, since the room next door had enough C4 packed into it to sink a battleship.
Exiting they found that Caldera and his partner were in position to breach the final door. Revenant and his partner moved into position and at the signal Caldera kicked in the wooden door. The fireteam stormed in, screaming at the technicians inside to get down. A guard tried to fire on the team, he missed and nailed one of the consoles instead. A bullet hit one of the technicians in the shoulder. Revenant wheeled on the shooter and drew his UMPs; activating the laser sights in the process. The twin dots rested on the assailant, one on his chest and the other on his forehead. The guard made to move, but never got the chance. Revenant pulled the triggers and a quick hail of .45 rounds ripped into the guard who fell to the ground in a pool of blood. Holstering the UMPs Revenant drew his SOCOM and fired a shot into the air. All the technicians ducked as the round hit the ceiling.
Revenant: Caldera, Fulcrum, Bind these people’s hands; Gobi, check that man’s wound. I’ll see what I can get from the consoles that weren’t just shot to hell.
As the other team members followed their orders Revenant began checking through the screens on the computers on the room, nothing of importance was coming up, except that all the messages that were sent from the consoles were sent to a user by the name Lionhead 666 @ anarchy . net. Figuring this would be an important bit of intel Revenant copied it down and gave the order for all the hostages to be cleared out of the building, including the incapacitated ones. The team obeyed and Revenant began setting C4 in the room. He set ten two pound bricks, and set them all to the same frequency as those in the armory. Double-checking that he wasn’t missing any intel he left the room. Outside all the hostages were bound and led away from the structure. They were knocked unconscious after Revenant interrogated them all, which didn’t take that long. No one had any viable intel, they were only told to relay whatever messages they received to the aforementioned address and not to ask questions. As good policy they left a knife in the middle of the group of technicians and guards so that they could free themselves, as ODST policy did not allow any ODST to leave anyone in a combat zone with no way to defend themselves. Leaving the techs they returned to the rest of the Squad.
Revenant: So, Polaris, how’d things go while we were in there?
Polaris: Well, we nailed about a half dozen guards as they entered the clearing for you; other than that, pretty boring.
Revenant: Well, I’ll try to make this a little more fun for you next time. Lets call for extraction.
Revenant called an MH-60G over his radio. Moments later it appeared above the clearing. It touched down and the ODST loaded in. Once everyone was in the pavehawk lifted off and began flying away, Caldera was given the order to hit the detonator. The shack disintegrated in a ball of fire. Revenant gave the order to the pilot to leave in a hurry.
Pilot: Roger that, Generian Flight Control, this is Nightstalker 6-7 we are returning to base, ETA thirty minutes.
The Pavehawk turned and began the flight back to base, staying just low enough to avoid missile and AA attack, yet just high enough to evade small arms fire.
Generic empire
03-07-2005, 18:48
((OOC: Shenyang, you really have to stop treating the BLA like frightened schoolchildren with popguns. I've tried to make it clear that their members, with their experience and training, are the guerilla equivalent of any first world special operations team, but consistently you manage to sneak up on them with their pants down. In a warzone, I'd suspect they wouldn't be hanging around in the middle of the night inside, with one lazy sentry chilling outside without a radio. They may not be as well equipped as allied forces in the region, but they have equivalent communications capacity. These men are not the group of retarded minutemen you seem to think we are fighting here.))
Carthago Deuce
04-07-2005, 01:07
"Well, here I am.", thought Leiutenent Alois to himself as he stepped off the ferry which had brought him up the river Deska to the city of Deskograd, "Time to get to work."
He was there to locate and make contact with the BLA, and if possible the BNA, to let them know they would shortly be recieving the suppport of Carthago Deuce, and get information on force deployments, bases of opperation, safe houses, etc. which his comrades in arms would be able to use once in country.
Freudotopia
04-07-2005, 01:29
((OOC: Shenyang, you really have to stop treating the BLA like frightened schoolchildren with popguns. I've tried to make it clear that their members, with their experience and training, are the guerilla equivalent of any first world special operations team, but consistently you manage to sneak up on them with their pants down. In a warzone, I'd suspect they wouldn't be hanging around in the middle of the night inside, with one lazy sentry chilling outside without a radio. They may not be as well equipped as allied forces in the region, but they have equivalent communications capacity. These men are not the group of retarded minutemen you seem to think we are fighting here.))
OOC: And on a related note, please stop writing your posts like a script. Use quotation marks, PLEASE! It's not that the RP is bad, it just loses a lot of the feel when you write it the way you do. Just put shit in quotes instead of saying
"Revenant: Blah blah blah. KILLING! Blah blah blah.
Soldier: I just killed half the BLA with one hand. Those guys sure are schoolchildren with popguns.
Revenant: Yeah. Totally. Hey, I guess there's no point for an RP if the enemy is the military equivalent to the Tampa Bay Devil Rays."
GE makes a good point about the content of the posts, so I thought I'd ask you to make yours read more like a story, more like a book. The way you do it tends to make things very choppy.
Godspeed.
Generic empire
04-07-2005, 01:47
OOC: And on a related note, please stop writing your posts like a script. Use quotation marks, PLEASE! It's not that the RP is bad, it just loses a lot of the feel when you write it the way you do. Just put shit in quotes instead of saying
"Revenant: Blah blah blah. KILLING! Blah blah blah.
Soldier: I just killed half the BLA with one hand. Those guys sure are schoolchildren with popguns.
Revenant: Yeah. Totally. Hey, I guess there's no point for an RP if the enemy is the military equivalent to the Tampa Bay Devil Rays."
GE makes a good point about the content of the posts, so I thought I'd ask you to make yours read more like a story, more like a book. The way you do it tends to make things very choppy.
Godspeed.
((OOC: Now, now. Let's not turn this into the world's largest Rip On Shenyang Thread. The script post style is perfectly fine. That is unless you don't like movies, which means you are my enemy.))
Freudotopia
04-07-2005, 01:59
((OOC: Now, now. Let's not turn this into the world's largest Rip On Shenyang Thread. The script post style is perfectly fine. That is unless you don't like movies, which means you are my enemy.))
OOC: Very well.
Carthago Deuce
04-07-2005, 22:26
Three days spent discreetly asking around had brought Lt. Alois to a rather seedy looking establishment, a dinner of some sort, on the western edge of Deskograd. He had been told by a low level BLA recruiter that he should ask for a "Yaromir" here.
"Good afternoon young lady," said Alois, addressing a youngish waitress, "Do you know if there is a man by the name of Yaromir here?"
"Yes, my father is here. In the back right now, though. Would you like me to tell him you're here?" replied the waitress.
"If you could I would be gratefull. Tell him Mr. Alois is here to discuss the Lew Valley. He should be expecting me."
(OOC: GE, just wondering if you want to RP the agent my guy is meeting with, or if you want me to do the whole thing.)
Eight silhouetted M1551 jeeps approached the shore in a most strange fashion. Lashed to a few buoyant devices, such as empty oil drums, the jeeps were slowly rowed to shore by two of the six men in each vehicle. Just as the first hit shallow water, the rumbling of an engine started and the officer in command, Karalyi, turned to see the others.
Not only were the 48 men there, but several other people arrived to see the spectacle of people in uniform. What especially intrigued them was the fact that a small majority of the soldiers were elves. Their uniforms were a bluish grey and and on one arm was a circle, half black and half yellow. The weapons they carried were mostly FN-FAL rifles, a few M60 light machine guns, and a couple of interesting 'portable howitzers'. These were small tripod-mounted cannon that could be loaded like artillery guns and used a light round. Untested in battle, the utility of these weapons was to be found. Lastly, they wore a field cap instead of a helmet, mostly due to weight.
Koralyi, an elf himself, looked at his map.
"Eh.. Paul, it was Derograd, right?"
"Yes, sir."
"Good, we'll skirt the river. Let's go."
Paul signaled the rest of the unit and the strange-looking jeeps headed in a column down a dirt path north toward Derograd, aside the Dedrovka river.
OOC: If you don't like the elf thing, i'll just ditch my involvement. Anyway, I hope I have a decent intro.
Generic empire
05-07-2005, 05:59
)(OOC: Carthago Deuce, if you're up to it, feel free to RP the whole meeting. Barkozy, no problem with the elf thing so long as you don't use any magic or something wierd like that. IC posts tomorrow. Too sick to type anything decent right now.))
OCC:Mine if I join, just found the thread.
IC: Leopold Strass was a reporter for the Republic News Network. He arrived in the province, his first job was to visit Ft. Lew.
Freudotopia
06-07-2005, 02:00
OOC:
GE, will you be writing individual contracts anytime soon? Or maybe in the aftermath of the Lew Valley. Yeah, that would be a good time.
Kroblexskij
06-07-2005, 17:50
The Media Tent
Well this is the place that we will be staying for the next few weeks - its drab and plain but functional.
Our equipment will be arriving from the carrier Nogalstic, and all food supplied by the crew truck and families you'll be staying with. The guide will be a local who knows the landscape, the army has been warned not to fire at Orange targets but the BLA may not be so happy. But we are a neutral crew and dont want to cause any harm, just film the life of them.
,Now lets get those pictures, i'm looking for horror, carnage, landscapes tanks, men, firefights, anything. Just get it and stay Alive.
---the men and women filed out of the drab green tent with orange roof the TV jeeps and trucks drove off to the rendevouz with the Locals. they would be filming behind the frontline with the Buchanians and getting to know them it would be a dangerous job but worth the viewings and getting the truth.---
Doomingsland
06-07-2005, 18:09
Reclining back in his cheap metal folding chair, Marcus stared at his laptop screen for a few minutes, reading over the message he'd just recieved. He sat in a small, simple tent, a wooden bunk off to the side with a metal locker containing his armor and personal weapons, and a trunk containing what few personal items he possessed. He considered what little he had to be too much as it is. He liked to travel light. He wore black camo fatigues, a .45 hanging off of his belt. He personally didn't like these non-lethal ops, but whatever his Generian hosts wanted...
Stepping out of his tent, he yelled for Lieutenant Kaeso Meridius to come.
Meridius, a man in his early thirties, looked ancient. His hair was already greying, and his eyes betrayed wisdom far beyond his age. He was a soft spoken yet stern man.
"What can I do for you, sir?" he asked pleasently.
"Kaeso, intell just came in on some high level BLA informant meeting with a general at a known enemy stronghold." said the colonel bluntly. It had the desired effect. They'd never gotten the chance to take down someone of such a high rank in this theatre.
"You wish for me to kill them, sir?" asked Kaeso in the same pleasent tone.
"Negative, Lieutenant. We want them both alive. And be subtle about it."
This caused a frown to come across the face of the lieutenant.
"As you wish sir. I depart now in the name of the Emperor." he said seriously. As if robotically, the Colonel replied,
"Strength and Honor, my brother. Go now."
Walking back to the fire he and his team had camped around, he explained the situation. They were most eager, having been bored out of their minds for the past month or so. It also gave them the chance to play with some new toys they'd been issued: the M-91A1 submachine gun and an attached non-lethal munitions delivery system.
Pulling on his armor and slapping on his Roman-esque helmet, Kaeso picked up his SMG off of the wooden bench the men had been sitting on and slung it over his shoulder. Heading towards the awaiting MV-68, he decided he had a bad feeling about this mission...
--------------------------------------------------------------------------
Amidst the dim red light that illuminated the troop compartment of the Banshee transport VTOL, Kaeso looked slowly at the other three men that made up his team, designated "Chalk One" for this op. Their visors concealed their scarred faces, cut and mutilated during their brutal training excersises. These men were green: they'd never seen real combat in Bucchiana. However, that wasn't to say they'd never seen real combat. They'd all been through hell back in that frozen wastland the locals call "Alberia"...
As the HUD began to indicate the transport's rapid approach onto the LZ, Kaeso stood, grabbing onto the rail that addorned the cieling.
"LZ looks quiet, ETA thirty seconds!" yelled Sergeant Titus Afranius, the pilot of Super-Six One.
The hydrolics of the ramp door began to croon, and the door inched open, revealing the quiet, darkened town below them. Fresh air instantly shot into the compartment from the outside. The men had gotten used to such a sensation from hundreds of insertions, so no one was surprised when they were hit by such force.
Watching from who-knows how many miles away, Colonel Gnaeus and his command staff casualy watched the LCD sceens, one for each of the four infantrymen and two for the transport. The aircraft quietly hovered over the roof of the target building, and the men dropped down, landing softly as dust from the ground kicked up by the aircraft's engines filled the air. It was twighlight, so the men had just enough light to see, yet it was dark enough for the aircraft to infiltrate. Upon their successful insertion, Super-Six One's engines vectored back into position, and she climbed to an altitude of ten-thousand feet to orbit the target area.
Shouldering his weapon and aiming it towards the door, Kaeso motioned for one of the men to open it. Finding it unlocked when he tried the handle, he stepped out of the way and threw it open. Kaeso immediatly rushed into the small stairwell. They found one flight of iron stairs in a brick chamber leading downwards.
The men catiously moved down, their weapons trained at a door at the bottom of the steps. Upon reaching it, Kaeso withdrew a small fiber optic camera and snaked it under the door. The scene through the camera's lense was projected directly onto his HUD: two gaurds, one asleep in a metal chair by the door closest to them, the second leaning against the wall on the other side of that same door taking a drag of his cigarette.
Signaling to his men what he saw, he stood up, assuming the same position he'd taken up last time in front of the door, his weapon shouldered and aimed towards the approximate area of his target's head, but this time had drawn his Long Knife, holding it in his left hand while his right sat firmly on the pistol grip of his weapon, his left forearm supporting the weapon.
As before, his comrade ever so quietly threw open the door. Kaeso quickly adjusted his aim, putting the red dot reticle of his submachine gun directly over the head of the man smoking the cigarette. Gently tapping the trigger, the weapon recoiled against his shoulder as a single silenced round shot out, hitting the man squarely in the temple, blowing the other side of his head out and spilling blood and grey matter all over the wall and floor. The man who had, until Kaeso had taken the shot, been asleep looked up at this new threat, his eyes wide with terror. The Legionary quickly lunged at his surprised foe, catching him in the throat with a back-handed slash with his knife, and put his right hand over his mouth to keep him from screaming, letting his gun slump down to his chest and hang from the strap. Blood had been spattered all over his visor, and he moved his arm to wipe it off, staining his black uniform. As his victim went limp, Kaeso wiped the blood from his blade and sheathed it, gripping his gun once more, tucking it tightly against his shoulder.
No one had heard the ruckuss, thankfully, and the men were able to move on about their bloody buisiness.
Moving up and crouching in front of the door the fallen rebels had been guarding, Kaeso once again withdrew his trusty optic cable and slipped it beneath the door. They'd already heard voices coming from the other side, and figured that this room, being guarded, was their target area. They guessed right. The image projected on their HUDs showed several rag-tag men in camo fatigues sitting around a table adorned with maps and coffee mugs within a cigar-smoke filled room. Their targets were in plain sight, sitting across the rectangular table from one another. As he moved the cable back and forth, scanning the room, he found two pairs of legs standing to either side of the door.
Damn, they're thourough... thought Meridius to himself as he withdrew the cable from the crack beneath the door, tucking it back into a pocket.
Motioning for the men to prepare to breach the door, one of the Legionaries reached into a pocket and removed a small C2 charge. He quickly placed it over the door knob, and motioned for the others to get out of the way. He clicked the red button on the detonater, causing the door to blow inward. This was immediatly followed by a flashbang grenade. Dust filled the air, and the BLA men immediatly raised their rifles and trained them towards the door, only to be blinded as the flashbang went off.
The Hunter-Killers quickly stormed the room, Meridius being the first man in. He dashed through the door and pivoted immediatly to the right, immediatly raising his weapon to confront the blinded guard. He emptied six rounds right into the man's head, blowing it clean off, and turned to see their two targets go down from taser hits.
The general and informant were quickly secured and hustled up towards the roof. They found their transport waiting right their, and they threw their captives aboard, yelling for the loadmaster to seal the door behind them. As it edged shut, they could hear bullets ping off the sides of the aircraft. They just stirred up the hornet's nest.
"Everyone buckle up, this is gonna be a close one!" yelled Sergeant Afrainius from the cockpit as the sky was filled with fluffy black clouds of death. Shrapnel pounded the the aircraft, but its tough armor held up. Well, that is, until the BLA scored a direct hit to the cockpit with a 23mm flak round, blowing the two pilots to smithereens, and causing the aircraft to go tumbling to the forest below...
Koralyi noticed a city in the distance. However, along with this city was a BLA checkpoint and the convoy stopped. Paul stepped out of the jeep and handed the leader a letter. The BLA man read it and chuckled.
"So.. you're Barkozians?"
"Yeah."
"Just head north and find somewhere to stay. Someone will be over there to give you more detailed orders."
Paul got back into his crowded jeep and drove through Derograd, heading into Lew's Valley. The convoy stopped when Koralyi and Paul found a few buildings including a petrol station and a store.
Koralyi said, "It looks abandoned. Maybe we ought to camp here."
"Yeah, it'll be nice to be able to camp out in these buildings."
Paul waved everyone off the jeeps except the drivers and they headed for the large store. He then knocked on the front door, making sure no one was there. Koralyi pushed Paul out of the way and then bashed the lock of the door with the stock of his rifle and walked in, looking around the empty store. Most of the things there seemed to be looted, but it was shelter. The jeeps parked near the gas station and some of the men walked that way to help remove the oil drums from the jeeps. Others got a ladder from the store and headed to the roof. Koralyi walked outside while Paul inspected the inside of the store.
"You guys set up shop up there, two of the howitzers and two LMGs to provide overwatch."
Those on the roof looked puzzled. One of them then said,
"Sir, uh.. how do you want us to get the guns up here?"
"Figure it out, Lieutenant!"
A voice then came from the road.
"What the hell are you guys doing?"
Koralyi looked behind him to find a BLA officer. He seemed genuinely startled.
"We're setting up a defensive position.."
"Get them down from there. You're going on a patrol in Lew's Valley."
"Oh.. right. I apologize."
The elven commander never really thought about doing the mundane, it was always about the heroic defense or the tough attack, there was no in between for him. Koralyi looked for action in taking this mission and now it would be there. Excitement took over reason in attempting to set up there.
--
In approaching the Valley the Barkozians used their jeeps in the usual convoy arrangement and stayed on the wider paths, trying to avoid traps. It was fruitless, as only two men in the force actually knew what a land mine in the ground looked like, and they were in the rear of the column. It was a recipe for disaster. No one knew better, primarily because these men had never seen combat.
After a bit, they stopped. The second vehicle in the convoy got bogged in the mud and some of the soldiers tried to dig the jeep out of the mud while others wandered around near the column.
Koralyi hastily tried unsuccessfully to slap a mosquito from his neck. He stood at the front of the column trying to figure out where he was going.
(OOC: If you want to fight my people, that's fine.)
Carthago Deuce
07-07-2005, 08:58
The waitress goes behind the counter and dissapears through a door, only to return alone moments later.
"My father is busy cooking right now, and has asked that you be patient and wait a few minutes, until he's done." said the waitress upon returning, "Could I get you something to drink while you wait?"
"Sure, tea would be lovely if you have it, water if you don't." replied the Lieutenent with a personable smile.
***
Lieutenent Alois had been sitting at the counter nursing his cup of tea for about twenty minutes when he was approched by a slightly overweight, middle-aged man who had a hard glint in his eyes. He stood up, shook his hand and said "Mr. Yaromir, I presume?"
"No, Mr. Charkov. Yaromir is my given name." said the man, gripping Alois' hand, "Please follow me."
With that Yaromir led the Lieutenent through the door behind the counter, back to a storage room full of dried/canned goods, and through another door; this one hidden by a shelf on hinges. This door let them into an unlit stair well, which went down about thirty or fourty feet and then stopped at another door. Yaromir knocked several times and a slot on the door slid open.
"Who goes there?" asked the pair of eyes which looked out from the slot.
"Yaromir Charkov. And a foreign guest. The password is 'One bright morning in the middle of the night
Two dead boys got up to fight'.
"Welcome, Yaromir. How's your daughter?" said the eyes as the slot closed and the door opened. Beyond the door was a small room with a table, a coffee pot, and seven very well armed guards.
"She is well, thank you." Yaromir said to the inquiring guard, leading Lt. Alois (now also accompanied by one of the guards from the room) through a trap door hidden under a tile in a slightly larger room, though it was uninhabited and furnished only with a desk.
"This place is posetively labyrinthian." commented the Lieutenent when they reached what appeared to be an office after taking several more turns and passing several other doors and security points.
"It's taken us four years to build it out to where it is now, but it is a work in progress. But no more about us just yet. Tell me about yourself, and just who you represent. All the friend of mine that you spoke with told me was that you were a foreign national looking to aid us in a large way. What exactly did he mean?" said Yaromir to Lt. Alois, taking a seat behind a desk. The Lieutenent taking the seat opposite Yaromir, and the guard remaining outside.
"I am Lieutenent Bernard Alois of the Werewolf Special Infantry of Carthago Deuce. My country, upon hearing your bid for freedom, elected to support your cause. It was decided however, that because of the size of the Generic Empire, and the international support it was recieving, that it would be far to great a risk to send in a large force to assist you in your efforts. We would prefer to avoid being invaded. This in mind Fleet Admiral Brennus dispatched a single Company, abeit a reinforced Company, of Werewolves to support you." replied Alois.
"How many men is that?" Yaromir interupted.
"One hundred ninety two. And myself. We are organised into a single Company of five Troops. Each Troop is made up of four twelve man sections, which are in turn divided into three four man fireteams.
I am here to help coordinate the Werewolves, the BLA, and the BNA; who we were hoping to help train by the way. Once I contact the CO of First Company I will be able to tell you where they will be, and some of what they intend to do. What we need from the BLA are maps, stratigic and tactical information, things of that nature so that we will be able to more effectivly combat our common foes."
"Are your men in country yet?"
"Yes."
"How will we be able to identify them?"
"They'll be wearing boonie caps, probably. Fairly standard BDUs, in a pattern that is somewhere between digital camoflauge and tiger-stripe. Light balistic armour, mostly for shrapnel, doesn't really stop anything more powerful than a 9mm round. And we wear these hight legging/gaiter things, looks like halfchapps. Other than that, we carry the standard Carthaginain assult rifle (OCC- Think the M-14/M1a EBR, but in a bullpub configuration and re-chambered for the 6.8mm Rem. cartridge) and a modified version of the M79. (the "Thumper II", like the M79 but semi-automatic, recoil operated and fed from a four round permanent magazine. Reloaded with a stripper clip.) I think thats about it."
"Okay. I'll talk to my people. Contact your commanding office and tell them to that we talked, and to prepare to move."
"Thank you, Mr. Charkov."
Shenyang
07-07-2005, 23:07
(OOC: Lets see how this works out... note that the defenses in this are hastily set up, and therefore not on par with those of an actual base, where there are established patrols, these are merely search parties)
Somewhere in the Lew Valley within a forty mile radius of Fort Lew (around 2:00):
Alpha and Bravo squads were slowly creeping toward their objective. A downed SAF MH-60L Pavehawk, it had been carrying two ODST from Delta squad, a pair of snipers, after a short recon of a possible target, which had turned out to be nothing more than a simple farm house which happened to have satellite dishes for three TV providers. From reconnaissance of the area prior to the snipers arrival it had appeared that it may have been a communications relay station. The snipers had carried their mission out unseen, as there was no one to see them.
However, as their Pavehawk was exfiltrating them from the mission area it came under fire from a roving BLA patrol and a well placed Stinger missile had brought the helicopter down in the forests. As the chopper went down it sent out an emergency signal, once the area was believed to be clear the rescue effort had been initiated. Sources said that the crash site was covered in BLA soldiers, and there were more than likely going to be roving patrols in the jungle, looking for survivors who had run from the crash. As a result the squads were being extremely careful about where they moved, and how they did it. Roughly a mile from the crash site Alpha squad encountered the first patrol. Three men with rifles and what appeared to be starlight scopes were sweeping the area for any signs of survivors. Knowing that the squad would be detected no matter what they did Revenant gave a quick order, "advance and take them down at all costs."
The squad followed the order, slowly creeping through the underbrush. One of the ODST stepped on a stick, it snapped and immediately the patrol ahead was scanning their position with the Starlight scopes. A laser sight attached to one's rifle steadied on the chest of one of the ODST, Raven, and immediately Raven opened fire, his rifle's flash giving away his position to the other BLA. They began to fire at where the rounds had come from; ducking behind a tree for cover Raven could here the BLA firing into the tree, rounds slowly burrowing into the wood. He'd missed his target, and now he was compromised. The rest of the squad tensely waited for the opportune moment to fire, right as the BLA had to reload. Raven ducked back out from his cover early, firing his AK-110, for his miscalculation he ended up with a round through the left shoulder. Falling in pain he saw one of the BLA fall with him.
Raven: Good, at least I took one of those bastards with me.
Blinded by the pain he lay on the ground. At this moment the remaining BLA were forced to reload. Rising from the underbrush the other ODST began firing at the BLA. Nighthawk, the squad's medic rushed to aid Raven as the others took down the BLA.
Nighthawk: You're gonna be okay, just calm down.
Raven: Getting hit sucks! ARRGH!
Raven began to lose consciousness.
Nighthawk: Stay with me man. Dammit stay with me.
Nighthawk punched Raven in the head just hard enough to wake him up.
Raven: (speech slurred slightly) Shit! Did you have to do that?
Nighthawk: Look it’s a flesh wound, wait no, your collar bone feels like its fractured, but not bad, just enough to hurt like hell.
Raven: Great. At least he missed my neck.
Gobi: Well this is why. His scope was out of alignment. Probably dropped it, this scope is freakin' heavy.
Nighthawk: I guess that makes you the luckiest man alive, he was aiming at your neck, a click to the right and down and you'd be dead.
Raven: Dammit, I kinda wish he'd killed me.
Nighthawk: We can't take you with us, look, and stay hidden, kill anything that isn't us if it comes at all near you. We'll pick you up on the way back.
Raven: Got it, if you forget me you can bet your asses that I'll be coming for you when this is over.
Nighthawk: Got it.
Propping Raven up behind the tree with a bandage over his wound Nighthawk packed up his gear and fell into formation at the back of the squad.
Revenant: We've gotta get moving, one of those guys called in the disturbance, they'll be sending a team to assist, so we'd better get out of here. Raven, stay hidden.
Raven: Gottcha sir.
The squad continued toward their destination. Through the trees they could see the crash site. Off to the left they saw another patrol; they appeared to be about an eighth of a mile from the crash site at most. Meaning they should get ready for a major firefight soon. These guards also had starlight scopes, but this time the ODST had the element of surprise on their side. These guards thought that there was only one intruder and that he was being apprehended as they patrolled. They had heard the gunfire, but dismissed it as echoes from the other guards' rifles through the trees. They were still highly alert, but they weren't expecting seven heavily armed Special Forces operators to pop up from behind a log and blast them. So that is what the ODST did, hiding behind a fallen tree for cover from the Starlight scopes they prepared to pop-up and fire. A moment passed, and then they stepped into action, firing on the patrol before they could realize that there were intruders twenty feet away from them.
Off to the team's right they heard gunfire; no doubt Bravo Squad had alerted a patrol as well. Through the trees ahead the ODST heard someone yelling orders. It sounded like: "You, go to the disturbance over there, you to the one out that way, the reset of us will stay here and guard the prisoners."
They saw sixteen BLA heading their way, Bravo probably had the same number headed their way. The BLA began firing into the darkness toward the ODST in order to flush them out. Waiting for the BLA to approach slightly closer the ODST waited out the storm of lead flying past them.
Revenant: NOW!
The ODST began returning fire on the BLA ahead of them, in the process giving away their positions, but also taking a few BLA with them in the initial salvo. A grenade flew into the position of one of the ODST, Backfire.
Backfire: Shit!
He grabbed the grenade and threw it back, it exploded just far enough away from Backfire not to kill him, but the shrapnel did wound him enough to warrant calling Nighthawk.
Backfire: MEDIC! I need a medic!
Nighthawk: shouldered his rifle and ran toward Backfire's position, which was a small dip in the forest floor with a large rock for cover. Bullets whizzed over his head as he ran. One struck a magazine on his vest as he slid into the depression; it ricocheted off and buried itself in a tree, launching splinters in all directions.
Backfire: I'm pretty cut up here.
Nighthawk: No shit. I thought you just wanted my company. Let’s see...
Nighthawk began to work on sterilizing the larger wounds, they were located along the back of Backfire's arms, on his legs, and one on his right side, they looked bad, but experience told Nighthawk that they weren't bleeders, but the real danger from those wounds was infection. As he sterilized the wounds the rest of the squad continued to fire on the enemy. Taking a cue from the BLA ahead Gobi lobbed a frag grenade, but the BLA didn't have a chance to throw it back, as he'd cooked the grenade for three seconds and put it on a two second flight. It exploded right above the ground and took two BLA with it. Nighthawk finished what he could do in the field.
Nighthawk: Can you walk?
Backfire: Yeah, should be able to.
Nighthawk: Then fall back to Raven's position; we'll pick you both up there.
Backfire: Fine, he could use the company.
Backfire rose, with a bit of difficulty and began running crouched back into the jungle.
Nighthawk brought up his rifle and fired into the advancing mass of BLA, of which there now remained ten. Taking one down he ducked behind the large rock as a BLA turned to fire on him, bullets ricocheted off the stone and flew in various directions, all with no real effect except to make some soldiers on both side duck.
Polaris was firing over the top of a log when he saw one of the BLA pulling a frag grenade. Lining the man up in his sights he fired, his AK-110 severing the arm of the man with the grenade, he dropped it, which he hadn't pulled the pin on and began writhing on the ground, screaming. A follow-up shot into his general area stopped the sound. Another BLA fell, having taken a burst from Revenant's M249 SPW, this cut the odds to 7 on 6 in favor of the BLA, which wasn't a long-lived advantage as a lucky burst from Gobi's M60 took care of three more. In the distance to their right the squad could here the sound of a heated firefight. Behind them they also heard gunfire, but only sporadically, no doubt Raven and Backfire were busy dealing with the reinforcements the first patrol had called for. When the last BLA fell everyone breathed a sigh of relief.
Advancing toward the crash once more they could still hear the sound of gunfire from the right. They arrived on the left side of the crash site; the chopper had rolled onto its side when it crashed so they were invisible, since the remaining BLA were on the other side of the chopper with the prisoners. Guessing that Bravo would be a while they moved slowly and silently around the chopper. Revenant looked around the edge of the chopper and saw the prisoners, one of the snipers, named Pandora, and the pilot of the chopper, along with the co-pilot as well. Looking into the chopper Revenant saw the other sniper, his head thoroughly damaged, obviously dead, probably got thrown around in the crash, and hit his head on something very hard, like one of the walls, a blood stain on the back wall of the chopper showed where it had happened. After another few seconds both groups rounded the ends of the Blackhawk. The last six BLA were gathered around the prisoners. They fired at the squad immediately. The squad fired back. The air was filled with lead and a few minutes later all the BLA were dead, and the ODST had nearly taken another loss.
Bravo finally showed up, three men short.
Revenant: What happened?
Element: Well, we sort of got ambushed. In the process Errant was wounded pretty badly, he's back there. In that last firefight though, Council got hit, and fell back, but Seraph took one in the head, we couldn't do anything about it, he died instantly.
Revenant: Shit. Seraph and I went back a long way.
Revenant masked his grief well, he was used to seeing his friends die, during the Shenyangi War of Liberation he'd lost one of his best friends. He'd gotten used to the feeling.
Revenant: We've got two men injured. Backfire and Raven, they're back along our exfiltration route. You two okay?
Pandora: Bruises, scrapes and a broken rib, nothing that'll kill me.
Pilot: I'm okay.
Revenant: Get the others out of there.
Glint and Guilty climbed into the helicopter and lifted out the three bodies: the dead ODST, named Fox, the Payload Officer, and the Copilot. Revenant got everyone clear and lobbed a high explosive grenade into the chopper, destroying it so that it could not be used against the allies. Also so that none of its classified electronics could fall into BLA hands. Moving back out of the area both squads picked up their wounded and dead, and reached their exfiltration point without encountering any resistance. Exfiltrating at high altitude to avoid enemy fire they returned to base.
(OOC: A rundown of the casualties:
BLA: 48 dead
Alpha Squad: 2 wounded
Bravo Squad: 2 wounded, 1 dead
Delta Squad: 1 wounded, 1 dead
SAF: 1 wounded, 2 dead, 1 MH-60L Pavehawk destroyed)
OOC:Since, I believe, no one replied to me, I will continue with my secret agent-ness.
BIC:
--------------------------------------------------------------------------
The Mouths of The River Deska
--------------------------------------------------------------------------
The fourty-two men that had come were dining upon a small wooden table, inside a rickety tent, with the dead of winter surrounding them, gripping them with it's icey tentacles. Each man shook his head when asked if they would like warming alcohol; it was illegal in Yafor 2 and these men had grown up hating the substance.
"There is a standoff, then?" The man who spoke was carrying a small pendant, a symbol of the fact that he was incharge of this little gathering of the best secret agents Yafor 2 had. A bystander would recodnize him as the first man, who had lit the lantern.
"Yes." The BLA man said. The man sighed. "And who do you want us to kill?" They were planning to enter the fort at night and have a little killing.
OOC:Time to jump in, GE!
Generic empire
08-07-2005, 19:04
((OOC: I've been a little preoccupied these past days writing and posting the big exposition to 'Dynasty', so I haven't been able to post here, but now that I have that thread posted, I'll be paying better attention to this one. Everyone can expect responses in an hour or two, after I get a shower and some food.))
Generic empire
08-07-2005, 20:23
Colonel Jaroslav sat back in his chair and rubbed his eyes, sore from spending hours staring at the screen of the laptop set upon his desk. Field reports were coming in by the minute, and from the looks of it, things were going as expected. Many BLA garrisons had withdrawn into the jungles as the air cavalry arrived after short firefights with the Imperial infantry. There would be counterattacks coming in a few days, in greater force than before. Jaroslav prayed that they would be ready.
He looked outside. A light snow dusted the ground, the first sign of winter in the southern province. In the distance the thunder of artillery guns could be heard rolling over the walls of the Lew Valley and drifting into the lowland around the base.
“Colonel Jaroslav, sir, there’s a reporter just showed up. Said he was from Brydog. Name’s Strass or something.”
“Never heard of him. Check him for weapons and bring him in. I’ll see what he’s up to.”
The officer saluted and disappeared through the door to fetch the foreign journalist.
-----------
((OOC: Barkozy, since you’re approaching from the south, you won’t be encountering any Generian patrols just yet. The 40th Army presence is only really felt in the northern tip of the valley.))
-----------
-initiating tap trace…
-line clear
-beginning encryption process
-encrypting set one
-encrypting set two
-transmitting files…
Sender: Rostislav Mareki’ev
To: Yaromir Charkov
RE: ‘Foreign Aid’
I understand that you were recently contacted by an officer of the special forces detachment recently arrived in our nation from Carthago Deuce. As your communiqué clarified, the officer stated his intention to aid us through coordinating and training our forces. I will make it very clear that I do not appreciate such arrogance in assuming we of the BLA command cannot properly control our own organization, and I would suggest you communicate this to your friend as well. If the foreigners think their help is needed in our struggle, that they are saviors to our cause, then they find themselves sorely mistaken.
However, it is the opinion of Nikolai that these men could prove useful in the future, and that foreign expertise in the process of training a regular army could be effective. While I may not personally agree, I trust his judgment on the matter, and give you permission to direct the officer and his forces to General Bjeylic’s camp in the mountains of the southern Lew valley, to oversee training operations and wait for further communication on the subject of operations. General Bjeylic will provide them with all necessary maps and intelligence to facilitate effective operation.
There is, however, one operation scheduled for tonight that Nikolai has suggested may be a useful test of the foreginer’s mettle. A Generian military jet was shot down just under an hour ago. We are near positive it was taking photographs of BLA encampments in the valley in preparation for later bombardments and aerial assault. Our enemies will no doubt be sending teams to recover the camera. We need a team of our own to get there first and destroy it. The jet crashed in the center of a small mountain village just north of the mouth of the valley. Coordinates will be transmitted for you to give to the Carthaginian team leader if interest in undertaking the mission is expressed.
That is all. If any further developments arise, make certain to inform me immediately.
-Rostislav
-terminating transmission-
--------------
Hill 17, Generian Firebase AOB-17, callsign Viper
Artillery guns thundered on the ridge overlooking the valley, muzzles trained on an opposing battery set on a ridge just 300 yards away. The scene was reminiscent of one of the great broadside exchanges of the ships of the line from days long past, now revived in different form, away from the majestic expanses of the sea. A shell slammed into a wooden structure recently put up by construction crews. Splinters and charcoal flew everywhere as men scrambled for cover. Across the way a similar fireball flashed into the clear blue sky as a BLA bunker took a direct hit.
Amid the chaos, a single green painted GH-2 gunship crested the top of the plateau and flew in over the barbed wire fences and earth battlements that outlined the perimeter of the base. It descended quickly as the pilots made to stick the gunship’s wheels into the dust. The doors slid open, the internal PA system blasting Metallica as a dozen of the most ferocious looking individuals one could have laid eyes on jumped out, fully laden with equipment packs and green Kevlar vests, GIR-47s in hand.
Most were bearded, tattooed, and looked as if they had not seen the inside of a shower in weeks. Grenades hung from their body armor, and scowls hung on their lips. A particular individual with a Generian Imperial Army insignia branded across his neck, a pair of dark sunglasses over his eyes, and a full red beard covering his chin walked calmly towards the headquarters building as the helicopter lifted off behind them, to make the frantic journey back to Fort Lew. A shell slammed into a five ton truck a few dozen yards away, and was blown into the air in a brilliant display of flame and shrapnel.
Colonel Alex “12.7” Dushka slammed his hand onto his desk as he leapt out of the chair, watching the explosion outside his window. The radio on his desk crackled to life.
“Colonel, we’re being shot at!”
“Well damnit! Shoot back!”
The door burst inward at that moment and in strolled the largest beast of a man the Colonel had ever seen. He strolled right up to the desk and leaned over, forcing the colonel back a few feet in defense of his personal space.
“Who the fuck are you?”
------------------
BLA Base, The Mouth of the River Deska
Dmitri Merkov, the large BLA man and apparent commander of the sixty men making their home at the small riverside camp, considered the foreign visitors. They certainly seemed sincere, but he had been too quick to trust foreigners before, and it had cost him his left thumb. The attack on the Generian firebase was scheduled for tomorrow night, and foreign specialists could certainly be useful as extra manpower, but if he was betrayed, it could cost him his life and the life of his men, many of whom were relatives of his, cousins, nephews, brothers in law. He scratched his ragged red beard and stared at the man with the odd pendant. He spoke now, a hard and serious tone in his voice.
“Nikolai apparently trusts you, otherwise he would never have let you set foot on our shores. He is a good man, a smart man, but sometimes I feel that he does not consider the full spectrum of a man’s motives. Tell me why you are here. Why are you helping the BLA If your answer satisfies me, you will come with us to the Generian firebase tonight, and we will kill the tyrant’s soldiers together. If your answer does not satisfy me, you will leave Buchiana.”
Carthago Deuce
08-07-2005, 23:06
Lieutenent Alois was being escorted to the office used by Yaromir Charkov. After his initial meeting with the BLA officer he had been asked to wait in the compound under Deskograd until Yaromir had made contact with his superiors, so he'd been sitting in the compound's mess hall/lounge area making small talk with BLA personnel for the past three hours.
Upon entering the office the guards once again took posts outside the door.
(OCC- GE, will you be wanting me to continue to RP Yaromir or do you want to take over? And just to clarify, when Alois said "Coordinate the Werewolves, the BLA, and the BNA" he meant coordinate Werewolf opperations with those of the other two oganizations in order to maximize their effectiveness. I'm sorry it came across as if he was there to fulfill an administrative capacity within one of them.)
Generic empire
08-07-2005, 23:14
(OCC- GE, will you be wanting me to continue to RP Yaromir or do you want to take over? And just to clarify, when Alois said "Coordinate the Werewolves, the BLA, and the BNA" he meant coordinate Werewolf opperations with those of the other two oganizations in order to maximize their effectiveness. I'm sorry it came across as if he was there to fulfill an administrative capacity within one of them.)
((OOC: Don't apologize. Everything is completely IC. Rostislav Mareki'ev is just paranoid. You can continue RPing Yaromir since you created his character.))
Carthago Deuce
09-07-2005, 02:03
"Lieutenent Alois, please take a seat." said Yaromir when the Lieutenent entered his office, "Some of my superiors have some concerens about your presence in our nation. Firstly they are not entirely sure if they want to accept your offer to assist in the training of the BNA, but are willing to give you a chance. Secondly, they see your offer to assume some sort of an administrative or leadership role in either the Buchianan Liberation Army or the Buchianan National Army as grossly arrogant. We have been a dedicated, organized fighting force for the past six years and are fully capable of leading ourselves and do not need to be supported in this way."
Lt. Alois was confused by the second point for a moment, until he remembered saying "To coordinate the Werewolves, the BLA, and the BNA." during their previous exchange.
"I seem to have worded my statement poorly; what I meant was that I would act as a middleman to make sure that the Werewolves would be able to best support the BLA and the BNA. Please tell your superiors that I appologize for the misunderstanding."
"I will let them know."
As for the first point, we are presently able to allocate only 96 men to act as instructors for the BNA, and as such would probably be best off if we had them observe your present training evolution and refine it if possible, maybe spend some time teaching your training personnel additional techniques or skills, but after that make their way to the field and join up with the rest of the Company. You have to understand that 96 men represents fully two fifths of our force, if you actually require a more dedicated group of advisor/instructors I might be able to have at most another two Troops deployed for that purpose."
"I don't think that will be necessary Lieutenent, but we appreciate the offer."
"Is that all then?"
"No. My superiors have said that your men are to report to General Bjeylic’s camp. He is located in the Southern Lew Valley. There you will recive the maps and inellegence you requested, and be integrated into our deployments.
Additionaly, they mentioned a mission, to test the resolve and effectivness of your 'Werewolves' which would take place this evening.", Yaromir takes a chart of the Lew Valley and surrounding areas and places it on his desk, "Somewhere here", he says indicating a small area on the chart, "a Generain aircraft was brought down by BLA fire. We are almost certain that it was carring a camera, which was used to spot our forces for upcoming artillery barrages and airstrikes. We need your men to destroy the camera and the film. Can you do it?"
"We can do it, but we would need the BLA to provide a transport vehicle to get our people up to that area. The whole Company is presently staying hidden in your Eastern Forests, just North of lake Deska. We can hoof it over to Bjeylic's camp in a few days, but without a helicopter or a truck or something we won't be able to make it to the crash site in time."
"I'll see what we can provide you with. How many men do you think you will need transported?"
"No more than two Section's worth, I think. Send enough transport for 24 men and their equipment, I will contact Major Young who is in charge of the company and set up a pick up. As for extraction, I think it would be best if you could drop them off in the vicinity of Bjeylic's camp."
"Good then. I'll contact my superiors and let them know you've accepted the mission, and arrange for a heilcopter or two for your men. Please contact your Major and arrange the pickup, then return and let me know where to send the transport."
"Thank you again, Mr. Charkov."
***
-initiating tap trace…
-line clear
-beginning encryption process
-encrypting set one
-encrypting set two
-transmitting files…
Sender: Yaromir Charkov
To: Rostislav Mareki’ev
RE: ‘Foreign Aid’
After further dialouge with the Lieutenent representing these 'Werewolves' as they call themselves it does not appear that they want to control or liberate us, but instead merely act in a supporting role. I misunderstood the Lieutenent's statement about "coordinating" our forces, he meant that he intended to act as a liason and do what he could to ensure that his people are used as effectively as possible.
The majority of the Werewolves should begin to relocate themselves to General Bjeylic's encampment soon, as per your instructions. Two of their units will be holding position and waiting for helicopter transport, as they have accepted the mission to destroy the downed aircraft you offered but have no vehicular transport of their own because of their covert nature. The coordinates are attached, please direct enough transport for 24 men and their equipment to that location.
-Yaromir
-terminating transmission-
***
"Major, incoming transmission." the comms officer said "Lt. Alois made contact with the BLA. He says we are to move to the following coordinates" the comms officer says as he writes down the coordinates of Bjeylic's camp, "Exept for two sections who are to move to a different location.", also writting down pickup coordinates, "The BLA needs to test us, so gave us a mission this evening which the two sections are to carry out. We need to destroy a downed aircraft that was being used to spot for artillery, and it's on board camera before the Generian forces recover it. Say to expect light-to-no resistance, pick-up is no later than 14:30."
"Okay. Provide the Troop leaders with the coordinates for the encampment we've been ordered to, and tell them to move out by the numbers. As if we were in hostile territory, which I suppose we are. Also contact Troop Echo and tell them to move their Third and Fourth Sections into position for pick-up, and to have them prepare for the worst. I don't want to take chances"
Generic empire
09-07-2005, 07:24
The last fingers of the sun were raking their way through the thick green canopy, drifting gently in broken patterns over the dirt floor. Day’s beacon was retreating behind the mountaintops, making way for her inky velvet counterpart. From the top of the ridge, the blue harvest moon was just appearing, the harbinger of winter’s cold embrace, bane of farmers, bane of soldiers. As the day’s warmth lingered about in the exposed rocks, a group of silhouettes picked their way towards a mound rising out of the floor, a cavernous entrance just barely visible behind a veil of green and brown, tangled weeds and vines that twisted up the thick roots lining the sides of the black maw.
Lieutenant Streteskyc scowled as he looked at what he was certain was the entrance to the local underground tunnel network the BLA forces had retreated into following the firefight on the plateau. Staring into the dark cavern now, he felt that it might rise from the ground and swallow him whole from where he stood. Looking over, he saw sergeant Kosyov, the Freudian, already moving towards the dirt mound, waving for him to follow. Taking a deep breath, Streteskyc waved his own men forward, and followed Kosyov.
He squeezed into to small entrance, and gave his eyes a moment to adjust to the gloom. Kosyov had removed a flare, and now it ignited, illuminating a long, winding dirt tunnel leading deep into the side of the mountainous valley wall. Kosyov dropped the flare, and removed a torch from his belt, strapping the flashlight to the side of his rifle, and flipping the switch. Streteskyc and his men had neglected to bring such gear, not expecting to be ordered to go spelunking at nightfall in a tunnel full of enemies. Therefore it was quietly decided that the six Generians (two having remained outside with 3 Freudians to make sure no more BLA soldiers intruded on the party down below) would be divided among the Freudian teams, so that if it was necessary to separate, no one would be stumbling around in the gloom.
As they moved forward, Streteskyc found it odd that there were no fixed lights running along the top of the tunnel to illuminate the path for BLA men. He stated his observation to Kosyov, who clarified the matter.
“Most of the tunnels these chaps dig are very well planned out. This long straight section here keeps the boys from getting lost on their trips to the surface, and it’s not illuminated to deter any passers by (such as our own merry band here) from poking around inside. Further up I’m expecting a divergence, probably about three additional tunnels which each split off into different rooms and corridors, if you will. They’ll be properly illuminated all right, but that doesn’t mean we won’t have an icicles chance in hell of not getting turned around.”
Kosyov halted suddenly and looked down. A tripwire lay across his path, a grenade buried in the wall on either side. He grinned sadistically.
“Clever bastards, aren’t they?”
He removed a pair of wire cutters and clipped the line.
“Watch your step, chaps.”
They proceeded forward about twenty meters, and, sure enough, came to an intersection, a single naked bulb hanging overhead, the path diverging in three separate directions. Kosyov looked around, before calling for one of his demolitions men to come forward. Streteskyc stopped him.
“Not yet. They’ll have a command bunker down there somewhere, and there’s bound to be maps of the complexes. If our armies are going to take these bastards on, we’re going to need to know the extent of these tunnels.”
Kosyov nodded.
“Good plan. Alright chaps, form up. We’re going to be doing a bit of spelunking.”
Streteskyc looked down each of the tunnels, illuminated barely by underpowered bulbs hanging at intervals along the top of the dirt corridors.
Leave two men here with explosives.”
He turned back to two of the Freudian soldiers.
“You two. If we get killed down there, you blow the mouth of this main tunnel, and seal them all in, then you high tail it out of here, back to the plateau.”
One of the soldiers spoke up.
“But sir, how do we know if you’ve been killed?”
Streteskyc grinned.
“When you see a whole hoard of those BLA howler monkeys coming down those tunnels.”
Streteskyc selected seven men, three of his own, and four Freudians, and set off down the center tunnel. Kosyov looked after them, and then back at his men, and sighed.
“Well, guess now’s the time, boys. Onward and downward.”
Eight men followed him, and the rest went after Sergeant Pepper.
Freudotopia
10-07-2005, 01:41
OOC: GE, that was quite the humorous Beatles reference. I laughed for 2.6 minutes. On to business. Do you want me to continue with ze tunnels, or do you want to do so?
Carthago Deuce
11-07-2005, 05:49
"Okay, we're comming up to the LZ! 60 seconds to landing! Prepare to dismount!" called the BLA soldier to the Werewolves as the helicopter carrying Third Section began it's rapid desent from just above the canopy to just above the tall grass in a meadow.
Petty Officer Second Class Robert Zuzen wasn't happy as he hear those words. This was mostly because he was sucking on a packet of 'Food Ration, Combat, Gelatin, Yucca Flavor' (which was the nastiest stuff anyone he knew had ever thought of eating. Lots of calories and vitamins though, and enough water per serving to facilitate healthy digestion without dehydrating the victim.) but partialy because he knew he would soon have to leave the relatively warm confines of his transportation and move into the much colder, darker air of the Northern Lew Valley.
"When you set foot on the ground move North East to the tree line! We will regroup there and then meet up with Fourth Section! Now prepare to disembark, you know the drill!" he said to his men as the BLA man opened the side door. He jumped the three feet to the ground and hit it running. Upon making the treeline he looked back and saw that the other eleven men of his Section had just about made it, with the boys of the Fourth right behind.
"Petty Officer Zuzen, on the way in Jacobs saw an orchard about a mile and a half to the North West of the meadow." reported Andrius, who was in charge of Bravo Fireteam, Third Section, "He says he saw a bunch of trees knocked over, and a trough of disturbed soil. I request your permission to go check it out."
"You have my permission, but remain within the treeline." he turns to the rest of his men, "Charlie, you will move North West about a hundred yards on Bravo's right. Alfa, we'll be at the same distance to their left. Delta you will be acting a rearguard and I want you to be in the center, about one hundred and twenty to one hundred and fifty yards behind the rest of the section.
Petty Officer Mikelo! I want you to move Fourth Section in a similar pattern, on the Third's right flank and heading North. Move out!"
***
Fireteam Alfa, Third Section, had just made it to the orchard when the Zuzen recived the call from his section's ground radar opperator that he had contacts, maybe a 15 or so, who were South East of them moving West. A few moments after that Mikelo reported that Fourth Section had made it to the orchard, and his ground radar man had between 18 and 24 contacts in the forest due East of his postition and heading directly for them.
"Petty Officer Zuzen, we have spotted the downed aircraft. It is out in the orchard two hundred yards North West of our position, can you see it?" said the leader of Fireteam Charlie over the radio.
"I see her, Korvas. Start moving your team towards the target, but be advised that we have contact to the South East and to the East of our positions.
Third Section, the aircraft is several hundred yards North of our position. Begin moving in on the target, but be stealthy about it as we have radar contact and we have to assume they are hostile. Fourth Section, form a skirmish line and begin moving towards the aircraft by the numbers. Zuzen, out!"
Generic empire
11-07-2005, 05:54
OOC: GE, that was quite the humorous Beatles reference. I laughed for 2.6 minutes. On to business. Do you want me to continue with ze tunnels, or do you want to do so?
((OOC: I'll be taking care of the rest if you don't mind. I'm already writing the next part of the tunnels.))
Generic empire
11-07-2005, 06:21
The whirling of the helicopter blades kicked up a storm of dust and loose topsoil as the GH-2 touched down in an elevated clearing, and a group of a dozen men jumped to the ground, first among them a hulking individual with a red beard and a military insignia tattooed on the back of his neck. He stood to his full height and looked around, breathing in the cold, clean mountain air. As the chopped dusted off, along with a second gunship fifty yards away, he bent his back and readied his rifle, a scowl plastering itself across his face.
“Captain Brenjov, the target is a mile and a half west of our position.”
The red bearded man grunted his approval and set off in that direction, the other 12 men melting into the forest after him.
---------
2 Hours Earlier
“Well, gentlemen, Strategic Command’s royally fucked things up again. According to General Nriv’ka, one of their goddamn spyplanes crashed in the woods about forty minutes ago, complete with a camera and a full crew of flying spooks. I’ll bet you can guess whose job it is to go fish the equipment out.”
Captain Rurik Brenjov balanced on two legs of the cheap metal folding chair, eyes closed, hands behind his head, barely listening to what the colonel was telling him. He could already guess what the operation would entail. From the initial reports, it would be a standard smash and grab. The complicated matter would be these BLA folk. He’d had experiences with them before, a year ago running special operations in the northern province when the insurgency was just getting on its feet, prior to the breakout of the full war. Apparently they’d grown up since his tour ended, and were no longer the rag tag band of farmers he’d been shooting at before. He was looking forward to seeing them again, firsthand. It had been too long since he’d experienced real competition. The colonel droned on.
“…so as you will no doubt expect, the BLA will be sending a welcoming party. Don’t forget, Imperial command needs those photographs if we’re going to properly coordinate the next stage of our assault. Don’t want to be bombing any mountain villages thinking they’re AAA outposts. That about wraps it up, gentlemen. Get ready to move. You’ve got an hour.”
Carthago Deuce
11-07-2005, 06:54
"Petty Officer Zuzen, the aircraft is fairly intact though most of the crew seems to have bailed out before impact. One was killed by the AA fire that brought her down. We are in the process of removing the film now." said Corpral Korvas.
"Good Korvas. I'm going to rejoin my Fireteam. Set the charges for twenty minutes. You have ten now to get everything secure and join up with the rest of the section." Zuzen replied.
"Sections Three and Four, this is Zuzen. We are almost done at the plane, and will be moving out shortly. Unfortunatly I see no way to avoid a firefight with the contacts to our East. There is about three hundred yards between our line and the treeline they will be coming from. When they get fifty yards into the orchard I want you boys with thumpers to drop a curtain of grenades right behind them at five yard intervals. Everyone, once those grenades go off, fire at will. And try to get headshots before they go prone, you know how these imperial types like ballistic armor. Zuzen, out."
The Werewolves had made it to the aircraft without being spotted, so Zuzen had ordered Fireteams Alfa, Bravo, and Delta to move in and reenforce Fourth Section's skirmish line while Fireteam Charlie made secure the film (Zuzen decided that even better than destroying it would be bringing it to the BLA for them to analyze) and destroyed the aircraft.
The numbers of contacts had been confirmed at 12 to the South East, who had since begun moving North towards the aircraft, and 24 due East. The ones to the South weren't much of a concern to Zuzen, but the contact due East was troubleing because of their extremely close proximity to his skirmish line (only about 500yds.) and the fact that the village he and his men were to be extracted from in about three hours was on the other side of them. He really didn't have much time for a firefight.
Generic empire
11-07-2005, 17:43
The man peered through the scope of his rifle, watching the figures moving around the downed aircraft 500 yards off. Lowering the scope, he shouldered the rifle, and began climbing down the thick trunk of the tall tree.
“Looks like they beat us to it, Captain. ‘Bout two dozen milling around the wreck. I don’t recognize their insignias.”
Brenjov stalked forward a few feet.
“Get low and move forward. The moment you have visual, open fire and hit the ground. We’ll end this quickly.”
The team advanced, their figures blending in with the thick foliage, weeds grabbing at their heavy boots. Eyes peered out from behind camouflaged faces, searching for their prey. They drew up on the treeline, and without warning, the clink of canisters against tree limbs met the ears of the soldiers.
“Get down! Kill the motherfuckers!”
As a rain of dust and dirt exploded behind the line of Generians, their enemies to their front opened fire. One of the soldiers went down, a bullet shattering his nose and lodging itself in his brain. Brenjov felt a bullet slam into his vest as he fell forward. Not bothering to check for penetration, he put the stock of his rifle against his shoulder and opened fire with his rifle, a GIR-47 and a slug thrower if there ever was one. Sporting 60 round magazines of lethal 6.5mm rounds, the gun was extraordinarily heavy, but with practice and strength, a weapon capable of making short work of soft targets.
About fifty yards north of Brenjov’s 12 man team, the second 12 man unit opened fire as the chaos of the firefight began to unfold.
Carthago Deuce
11-07-2005, 20:03
"Zuzen, we're done here. The aircraft is wired and set for detonation in fifteen. We are joining the skirmish line. Korvas called over the radio.
"Don't join the line! Move North, to about fifty yards beyond our line. Then move into the trees. Once you are there, come up behind the enemy position and use your grenades." replied Zuzen.
"Petty Officer Zuzen, we are presently under-fire by the contacts from the South! We are returning fire!" came the hurried response.
"Well get behind the damned plane! When they come looking for you let 'em have it. If they don't come looking for you continue with your originial orders!" said the Petty Officer, puting three round where he had seen a muzzle flash in the trees a moment before.
He took a moment to look down his line, what had been sixteen avenues of fire seemed to have dropped to thirteen. He'd have to request better armour when he got home. At least he still had his grenadiers, who were keeping up their fire.
As another wave of grenades burst along the enemy's forward line Zuzen got an idea.
"To all grenadiers, this is Zuzen. I want you to place a curtain of Incindiary HE rounds behind our enemies still within the tree line."
A moment later he heard the distinctive 'thoomp thoomp thoomp thoomp' coming from his seven grenadiers and was glad that it had been a dry cold, hoping that the fires set by the twenty eight grenades would be sufficent to force his enemy out of the tree line. He saw flashes, followed by a glow that silhouetted his enemies beyond the tree line.
Carthago Deuce
13-07-2005, 07:33
bump
Generic empire
15-07-2005, 19:25
This late in the year, the foliage of the dense forests was particularly dry, and something so much as a burning cigarette butt could set off a small conflagration. The incendiary rounds bursting did much more, and flames leapt up the dry trunks, engulfing leaves and setting the forest ablaze. The fire spread quickly, making a ring around the clearing, leaping from tree to tree.
Brenjov stood and looked around, his eyes blazing like the woods around him. He flashed his tormented gaze on the plane, through the rain of falling sparks and branches, and with a primal roar, charged through, firing at the plane where his foes were taking cover. From the north, a man looking like a risen phoenix rushed screaming from where he had covered, completely ablaze, his flesh charring and crisping under the thirsty flames.
The rest of the Generians broke cover and entered the clearing, scrambling for whatever cover lay, firing wildly at anything that moved while trees fell behind them and the red glow lit up the night.
Freudotopia
16-07-2005, 01:45
This late in the year, the foliage of the dense forests was particularly dry, and something so much as a burning cigarette butt could set off a small conflagration. The incendiary rounds bursting did much more, and flames leapt up the dry trunks, engulfing leaves and setting the forest ablaze. The fire spread quickly, making a ring around the clearing, leaping from tree to tree.
Kosyov stood and looked around, his eyes blazing like the woods around him. He flashed his tormented gaze on the plane, through the rain of falling sparks and branches, and with a primal roar, charged through, firing at the plane where his foes were taking cover. From the north, a man looking like a risen phoenix rushed screaming from where he had covered, completely ablaze, his flesh charring and crisping under the thirsty flames.
The rest of the Generians broke cover and entered the clearing, scrambling for whatever cover lay, firing wildly at anything that moved while trees fell behind them and the red glow lit up the night.
OOC: Uh...isn't Kosyov my guy? Did he get out of the tunnels?
Shenyang
16-07-2005, 18:25
OOC: Can I pull out the SNS Valiance in favor of a small airborne company? (No more than 80 guys) Since the Valiance only got worked into one post with anything amounting to a major role. When you get a chance to respond tell me.
Generic empire
16-07-2005, 19:43
OOC: Can I pull out the SNS Valiance in favor of a small airborne company? (No more than 80 guys) Since the Valiance only got worked into one post with anything amounting to a major role. When you get a chance to respond tell me.
((OOC: Sure. A larger group would probably be a better idea anyway.))
Carthago Deuce
17-07-2005, 01:08
(OOC- GE, could you please post losses/casualties? I've got three dead so far.)
Generic empire
17-07-2005, 05:47
((OOC: 2 dead from headshots, 2 burned in the forest fire, 1 caught a grenade between his thighs. A few others took bullets in their vests or suffered minor burns.))
Carthago Deuce
17-07-2005, 07:09
(OOC- Thank you.)
For a moment Petty Officer Zuzen was impressed by how effectively his idea had worked. After that moment he realized that he, along with his men, were now traped in the orchard; along with the plane which was about to explode and an enemy force that was about a third larger than his own.
'Well, at least they're out in the open now.' Zuzen thought as a tracer sped from the muzzle of his weapon and impacted the breech of a rather large and angry looking Generian's rifle, ricocheting into the buttocks of the man next to him.
"I'm cold!" he shouts, after trying to reload and finding he was out of ammunition.
As he reaches for his 10mm service pistol his radio comes to life; "Petty Officer Zuzen, this is Korvas. The plane is gonna blow in five minutes, and we are pinned down. Requesting covering fire while we re-locate."
"You got it Korvas. Kat, Pachel, I need you to redirect your team's fire to cover Fireteam Charlie while they get away from that plane."
No sooner had he said that than a grenade detonated behind him. He felt some rather uncomfortable sensations where some shrapnel had gotten into his legs, but nothing to serious as there had been a small tree between it and him. The man to his right, on the other hand, had fared much worse. His trousers were begining to turn red in about a dozen large splotches, and Zuzen could see a penny sized hole at the base of his skull. The man had stoped fireing.
The Petty Officer fired his pistol as he sidled over to the dead soldier, and relived him of what little ammo he had left.
"This isn't looking good." thought Zuzen, not for the last time that night.
Carthago Deuce
21-07-2005, 00:54
Dead thread?
Kroblexskij
21-07-2005, 18:33
well it was a good run, and it seems so
Generic empire
21-07-2005, 18:52
((OOC: Not dead. Busy defending myself from ViZion and taking CPR classes at night.))
Kroblexskij
21-07-2005, 19:16
a helpful course, ok im still here
Freudotopia
21-07-2005, 22:28
OOC: As GE stated, he (and I) are busy with CPR at the moment, and the whole CAD is gearing up for war because of an unprovoked attack by ViZion on Generia. Any nation that either loves justice or wants to ally with the mighty CAD and her many allies should go to that thread. It's pretty active, so just find it. Links are for dwarves.
Kroblexskij
22-07-2005, 13:10
im a dwarf
Freudotopia
22-07-2005, 21:22
im a dwarf
Fine, shorty.
http://forums.jolt.co.uk/showthread.php?t=433105&page=1&pp=15