NationStates Jolt Archive

I've never actually looked it up myself, but it's a common argument of IDers that supposedly proves evolution wrong. So, out of curiosity, I finally looked it up.
http://en.wikipedia.org/wiki/Second_law_of_thermodynamics

The Second Law is a statistical law and thus applicable only to macroscopic systems. When one part of an isolated system interacts with another part, energy tends to distribute equally among the accessible energy states of the system. As a result, the system tends to approach thermal equilibrium, at which point the entropy is at a maximum and the free energy is zero.
...hang on. I thought the IDers said it had to do with a system's complexity. Did I just kick the supports out from under one of the most pervasive and largest arguments of IDers? Or is there more to it, and I'm just being a simplistic idiot?

So...IDers...actual learned folks...what do you have to say on this?

...hang on. I thought the IDers said it had to do with a system's complexity. Did I just kick the supports out from under one of the most pervasive and largest arguments of IDers? Or is there more to it, and I'm just being a simplistic idiot?

So...IDers...actual learned folks...what do you have to say on this?

If one simplifies it a lot one could get: more entropy = less order = less complex structures. Which is what the IDers use as argument.

Small problem: the earth is not a closed system.

All creationist arguments are based on flawed science. Usually it's a flawed understanding of evolutionary biology.

All creationist arguments are based on flawed science. Usually it's a flawed understanding of evolutionary biology.
I'm not questioning that. I'm questioning why anyone would take the argument regarding the 2nd law of thermodynamics seriously.

I'm not questioning that. I'm questioning why anyone would take the argument regarding the 2nd law of thermodynamics seriously.
Creationists don't decide based on arguments, they invent arguments based on what they've decided.

To an extent entropy measures the 'disorder' of a system. However the system in question is a thermodynamic one. It makes no sense to apply the concept, in this form at least, to the 'complexity' of an organism, something which seems to me to be entirely arbitrary.

And anyway, as was said earlier, it only applies to a closed system. One conventially measured the change in entropy of the entire universe.

If one simplifies it a lot one could get: more entropy = less order = less complex structures. Which is what the IDers use as argument.

Small problem: the earth is not a closed system.

I've heard ID'ers make the argument that the universe itself is a closed system and therefore the second law can be applied to the universe and everything within it. Or something like that.

I'm not questioning that. I'm questioning why anyone would take the argument regarding the 2nd law of thermodynamics seriously.

Mostly it's due to what you just realized on your own... a lack of knowledge.

People take religious figures as authority. So when figure A says the second law is such, then they take it to heart w/o checking for themselves.

I've heard ID'ers make the argument that the universe itself is a closed system and therefore the second law can be applied to the universe and everything within it. Or something like that.

The overall entropy of the universe increases, but that doesn't mean it can't go down one place, and up in another.

Mostly it's due to what you just realized on your own... a lack of knowledge.

People take religious figures as authority. So when figure A says the second law is such, then they take it to heart w/o checking for themselves.
And then there's good old fashioned naivity. No matter how educated I become I will always be somewhat naive. I can oftentime be pursueded far too easily. It pisses me off at times.

thermodynamics is not the only way to disprove the existance of god using physics. electron diffraction is a quantum phenomina that causes electrons (a particle) to act as a wave, this is becuase the exact location, velocity, and spin of the electron are not determined. it has been shown in many repeated and credible experiments that if any of the properties of the electron are known then diffraction fails to occur.

thus is god is all knowing, then it would know the properties of the electron and diffraction would not occur. since diffraction does occur then it can be reasonably concluded that god is at least not all knowing.

I do not obey the second law of thermodynamics. Therefore I evolve.:)

Im not sure cuz I havent read the ID literature but I would assume they mean that the first viable single celled lifeform with DNA did not magickly and spontaneously exist from the hypothesized chemical soup that pre-life Earth was.

I've heard ID'ers make the argument that the universe itself is a closed system and therefore the second law can be applied to the universe and everything within it. Or something like that.
This is neither support, nor opposition for ID.

One of the real tricks to understanding how to solve thermodynamic problems is understanding how to define the system. I've found that trying to define an infinitely large system can cause some problems with understanding just how a thermodynamic process works. In my learned opinion, trying to define the Universe as a 'system' for thermodynamic purposes is a bit of a stretch of one's intellect.

Belief in any Creator is more of an issue of faith than of proof.

I do not obey the second law of thermodynamics. Therefore I evolve.:)

Im not sure cuz I havent read the ID literature but I would assume they mean that the first viable single celled lifeform with DNA did not magickly and spontaneously exist from the hypothesized chemical soup that pre-life Earth was.
Hang on, what? Please rephrase what you just said. I can't tell what you mean.

thermodynamics is not the only way to disprove the existance of god using physics. electron diffraction is a quantum phenomina that causes electrons (a particle) to act as a wave, this is becuase the exact location, velocity, and spin of the electron are not determined. it has been shown in many repeated and credible experiments that if any of the properties of the electron are known then diffraction fails to occur.

thus is god is all knowing, then it would know the properties of the electron and diffraction would not occur. since diffraction does occur then it can be reasonably concluded that god is at least not all knowing.
Physics is so crazy. Quantum, at least.

thermodynamics is not the only way to disprove the existance of god using physics. electron diffraction is a quantum phenomina that causes electrons (a particle) to act as a wave, this is becuase the exact location, velocity, and spin of the electron are not determined. it has been shown in many repeated and credible experiments that if any of the properties of the electron are known then diffraction fails to occur.

thus is god is all knowing, then it would know the properties of the electron and diffraction would not occur. since diffraction does occur then it can be reasonably concluded that god is at least not all knowing.
Would God know the state of Schrodinger's Cat? The common notion is that, since he is both inside and outside the box, he would; rather than an active observer, as we are, God would be a passive observer, like the human being is to its own thoughts, and thus could "perceive" everything without actually interacting with them in any way.

Anyway.

The Second law and Entropy argument deals with thermal equilibrium. The point is that thermal equilibrium is a macroscopic, not a microscopic, quantity. Individual particles can and do group up and exchange uncountably many packets of energy locally, thereby expressing complex systemic behaviour, without changing the overall distribution of energy in the system in the wider scale.

It was a weak argument from the start.

Of course it was. But why does it persist among those who've been shown it is an argument that does not work? Why do they claim to be scientific and then refuse to listen when their argument is proven wrong?

Of course it was. But why does it persist among those who've been shown it is an argument that does not work? Why do they claim to be scientific and then refuse to listen when their argument is proven wrong?
Because God told them they were right.

Because God told them they were right.
That's not an answer. It is not acceptable in scientific debate. If they wish to debate science, they can play by the rules or shut up.

I've heard ID'ers make the argument that the universe itself is a closed system and therefore the second law can be applied to the universe and everything within it. Or something like that.

Well thats a stupid arguemnt as if they are calling the universe a cloed system, Stars ruin the arguemnt, these use nuclear fussion to create moire complex atoms.. therefore in know way can you argue about the second law

That's not an answer. It is not acceptable in scientific debate. If they wish to debate science, they can play by the rules or shut up.
And that is why legitimate scientists refuse to argue with them.

If one simplifies it a lot one could get: more entropy = less order = less complex structures. Which is what the IDers use as argument.

Small problem: the earth is not a closed system.
Except you get systems that are many orders of magnitude more complex out of chaotic reactions than you do out of things that are well-ordered. In fact, until thermal equilibrium is aquired the nature of entropy would require that chaos thrive. If things were well ordered than maximum entropy could never be acheived. And the human body is far from well ordered.

Ah, as Nietzsche said, God is dead.

When the supposedly faithful must debate attempting to use reasoned science in order to assure themselves and convince others, they are not truly faithful, and as Nietzsche also said, according to their holy books, they are going to Hell as they do not truly beleive.

That's not an answer. It is not acceptable in scientific debate. If they wish to debate science, they can play by the rules or shut up.
Hey K-Y, sorry i'm so late to the party.
I have a link that may interest you here:

http://www.sullivan-county.com/nf0/fundienazis/25_answers.htm

...that's the first & foremost, along with this one:

http://www.sullivan-county.com/nf0/y2k/fund_sci.htm

But that root is quite useful, as are these coordinative links:

http://www.sullivan-county.com/nf0/fundienazis/fundienazi.htm

and

http://www.sullivan-county.com/id2/crazy.htm

and perhaps even ...

http://www.sullivan-county.com/news/fundie_cults/index.htm

---
I've got a bit more if you're interested.
BTW, what, no anecdote for me? :(

I'm not connecting where thermodynamics has any link to the truth or fallacy of evolution. :confused:

Hey K-Y, sorry i'm so late to the party.
I have a link that may interest you here:

http://www.sullivan-county.com/nf0/fundienazis/25_answers.htm

...that's the first & foremost, along with this one:

http://www.sullivan-county.com/nf0/y2k/fund_sci.htm

But that root is quite useful, as are these coordinative links:

http://www.sullivan-county.com/nf0/fundienazis/fundienazi.htm

and

http://www.sullivan-county.com/id2/crazy.htm

and perhaps even ...

http://www.sullivan-county.com/news/fundie_cults/index.htm

---
I've got a bit more if you're interested.
BTW, what, no anecdote for me? :(

I got half way through the first link and decided that these arguments were indeed rather crappy. Couldn't you find something half decent, Straughn?

I've never actually looked it up myself, but it's a common argument of IDers that supposedly proves evolution wrong. So, out of curiosity, I finally looked it up.
http://en.wikipedia.org/wiki/Second_law_of_thermodynamics


...hang on. I thought the IDers said it had to do with a system's complexity. Did I just kick the supports out from under one of the most pervasive and largest arguments of IDers? Or is there more to it, and I'm just being a simplistic idiot?

So...IDers...actual learned folks...what do you have to say on this?

I'm not an IDer, but I do like some of their arguments. Why? Let me try to show you, although I know this isn't a terribly simple issue, and I'm still a learner.

The second law of thermodynamics (SLT2) is basically a summary of what we know about our physical world. It summarizes what we have seen, what we have experienced, what we think will happen. Even people who have not heard about the law will recognise that rocks don't roll uphill, divers don't plunge from the bottom of a pool to the top of a 10 meter diving board--except in movies that are played backwards. And when we see movies played backwards, we might think them funny, but we aren't really fooled, since we recognise that they are so unlikely. SLT2 is basically a description of energy movement. Another example might be taking a hot pan off the stove and observing that it cools. The heat is transferred to the cooler surrounding air. The first law of thermodynamics says that you cannot destroy or create energy, and the second law describes where the energy goes.

Now when this is applied to the intelligent design debate, we see that when energy has a way of spreading out and becoming 'even', this is exactly the opposite to what we would expect for intelligence. We can look at life and see the complexity of DNA, proteins, lipids, carbohydrates, signal molecules, etc. Nobody argues about that. Trying to explain how that complexity came there seems to be exactly the opposite to what we would expect based on the SLT2.

There is actually nothing in the SLT2 that says that complex life could not come by naturally occurring forces (as opposed to a designer), but that it isn't what one would expect, given that we generally don't see rocks rolling uphill, or divers plunging 10 meters upwards.

The point about the earth not being a closed system is that in order for complexity to increase in the earth (to provide life), the randomness must have increased elsewhere (outside of the earth's system) to compensate. If the earth is not a closed system, than the randomness (entropy) may have increased in the universe (outside of the earth), at least theoretically.

Personally, though, I find that a weak argument, since we have no evidence of an increase in entropy outside of the earth's system that corresponds to a decrease in entropy within the earth's system, and not sensible hypothesis about how this could have occurred anyway (as far as I know).

Lastly, having studied biology personally, I should make the point that life itself is a tremendous energy. One of the simplest life forms such as E.coli could cover the whole earth, provided it had the right conditions, in far less than a year. It has wonderful powers of replication.
The information (e.g. DNA sequence) that life requires depends on high levels of energy, and high levels of energy are only possible with the right information. Given that life is such a powerhouse of energy, is it reasonable to suggest that this sort of energy could have become so concentrated and potent AGAINST the predictions of the SLT2?

Now when this is applied to the intelligent design debate, we see that when energy has a way of spreading out and becoming 'even', this is exactly the opposite to what we would expect for intelligence. We can look at life and see the complexity of DNA, proteins, lipids, carbohydrates, signal molecules, etc. Nobody argues about that. Trying to explain how that complexity came there seems to be exactly the opposite to what we would expect based on the SLT2.

Not used properly, it isn't. Even in inorganic chemistry, we see complexity from randomness all the time. Sometimes, especially in polymer chemistry, order is actually the state of higher entropy - because entropy is not directly a measure of complexity. Sometimes, the energy from one reaction is coupled to another reaction. The first reaction increases entropy, the second decreases it - but generally not to the same extent.

People who try to suggest that the Second Law precludes order forming from randomness have either completely misunderstood it, or are intentionally misusing it.

There is actually nothing in the SLT2 that says that complex life could not come by naturally occurring forces (as opposed to a designer), but that it isn't what one would expect, given that we generally don't see rocks rolling uphill, or divers plunging 10 meters upwards.

We are talking about molecular processes, not things like rocks rolling uphill. And, in molecular processes, we see order spontaneously forming all the time.

Given that life is such a powerhouse of energy, is it reasonable to suggest that this sort of energy could have become so concentrated and potent AGAINST the predictions of the SLT2?

If the law actually in any way predicted that this would not happen, you might have a point. Of course, you have already admitted that it didn't. Nothing like contradicting yourself.

I'm not an IDer, but I do like some of their arguments. Why? Let me try to show you...

No need.

You have already admitted in earlier threads, that you will choose 'faith' over 'science' when the two contest.

Not used properly, it isn't. Even in inorganic chemistry, we see complexity from randomness all the time. Sometimes, especially in polymer chemistry, order is actually the state of higher entropy - because entropy is not directly a measure of complexity. Sometimes, the energy from one reaction is coupled to another reaction. The first reaction increases entropy, the second decreases it - but generally not to the same extent.


Hi Dem. It's been a while.

Perhaps I should point out that we are not so interested in complexity as in information. For example, when a spontaneous chemical reaction produces ABABABABAB, we see high levels of order, like polymer chemistry. But this is not the information required for life. DNA sequences, for example, are far more than mere repetition or symmetry. Of all the DNA sequences I have scrutinised, I have never seen patterns. And yet I know that the sequence is very important for functionality, i.e life. In fact, if randomness could produce functional DNA sequences, it might be detrimental for life.


People who try to suggest that the Second Law precludes order forming from randomness have either completely misunderstood it, or are intentionally misusing it.


I agree. The order in a rock crystal, for example, is formed by natural processes, controlled by the Second Law. However, we need more than mere order for life. We need information. And information is often non-symmetrical, so that it is indeed hard to imagine 'random' processes providing information, particularly in the absence of anything already present to recognise it as information.


If the law actually in any way predicted that this would not happen, you might have a point. Of course, you have already admitted that it didn't. Nothing like contradicting yourself.

I still can't see the contradiction, but perhaps you might care to enlighten me.

DNA sequences, for example, are far more than mere repetition or symmetry. Of all the DNA sequences I have scrutinised, I have never seen patterns.

Really?

It's not even 'my field', and yet I've seen 'mirror' sections of human DNA.

No need.

You have already admitted in earlier threads, that you will choose 'faith' over 'science' when the two contest.

Did I? I don't recall that. But now if you were to put the question to me, which would I follow in a collision between faith and science........I'm actually not that sure. I've never been in that situation. Of course there has been collisions between faith and faith, or conclusions from one faith versus the conclusions of another 'faith', but never between my faith and science.

In fact, let me put a proposition to you, Grave. Why don't you come up with an example of a direct collision between faith and science that you think I might have had a problem with, and we can discuss it like civilised fellows.

Did I? I don't recall that. But now if you were to put the question to me, which would I follow in a collision between faith and science........I'm actually not that sure. I've never been in that situation. Of course there has been collisions between faith and faith, or conclusions from one faith versus the conclusions of another 'faith', but never between my faith and science.

In fact, let me put a proposition to you, Grave. Why don't you come up with an example of a direct collision between faith and science that you think I might have had a problem with, and we can discuss it like civilised fellows.

I'm not going to go trawling through dead-threads... It was evolution-related, but that's about all I can tell you offhand.

But - let's cover the bases... first... age of the world: Old like science insists, or young like a book says?

Really?

It's not even 'my field', and yet I've seen 'mirror' sections of human DNA.

Perhaps, if you mean all those repeats found in the human genome. Actually, I was thinking of my area (bacterial genomics) where such repeating DNA sequences are rare and do not tend to serve as information (other than as a type of 'distance' between genes that might impact transcription levels). I actually had in mind coding sequences of DNA. Perhaps I should have specified that.

I'm not going to go trawling through dead-threads... It was evolution-related, but that's about all I can tell you offhand.

But - let's cover the bases... first... age of the world: Old like science insists, or young like a book says?

Hmmmm, last time I read the Bible, it didn't say how old the world was. Popular current opinion suggests that the world must be very old. I allow that the world might be very old. It also might be a good deal younger than many people conclude. It's still an open question for me.

Next question.

Hmmmm, last time I read the Bible, it didn't say how old the world was. Popular current opinion suggests that the world must be very old. I allow that the world might be very old. It also might be a good deal younger than many people conclude. It's still an open question for me.

Next question.

I think you hedge your bets... I'm pretty sure you argued 'dating' techniques were way out, last time...

Origins of our species? Evolved or artifact?

Perhaps I should point out that we are not so interested in complexity as in information.

What is information in life, but a particular type of complexity?

For example, when a spontaneous chemical reaction produces ABABABABAB, we see high levels of order, like polymer chemistry. But this is not the information required for life.

No, that's more like ATCGGCATCGATTTCCCGGGATGC

Of course, polymer chemistry - spontaneously -can do the same thing, if you have four different monomers together. Add to that the fact that the monomers themselves conjugate to other monomers through hydrogen bonds, and you have a way to replicate them.

From a purely chemical point of view, DNA is a polymer - plain and simple.

DNA sequences, for example, are far more than mere repetition or symmetry.

So are most polymers. There are polymers that attach in an ABABAB fashion, but there are also polymers that would attach in a random fashion, much like DNA.

I agree. The order in a rock crystal, for example, is formed by natural processes, controlled by the Second Law. However, we need more than mere order for life. We need information.

Your information is derived from the order.

And information is often non-symmetrical, so that it is indeed hard to imagine 'random' processes providing information, particularly in the absence of anything already present to recognise it as information.

It isn't information unless you are looking at it as such. A DNA or RNA molecule could form, absent any of the copying mechanisms. RNA, at least, could self-replicate, absent any of the enzymes that make the process more efficient.

You are calling it information because you know what it does. Being information, however, is not inherent in the structure of RNA or DNA, any more than a random string of numbers is inherently information.

I still can't see the contradiction, but perhaps you might care to enlighten me.

There is actually nothing in the SLT2 that says that complex life could not come by naturally occurring forces

By this statement, one can conclude that the SLT2 would not predict that life would not form.

Given that life is such a powerhouse of energy, is it reasonable to suggest that this sort of energy could have become so concentrated and potent AGAINST the predictions of the SLT2?

Oh wait. Now you say that the SLT2 predicts that this would not happen - which is the same thing as saying that it could not happen, according to the law.

SLT2 is basically a description of energy movement. Another example might be taking a hot pan off the stove and observing that it cools. The heat is transferred to the cooler surrounding air. The first law of thermodynamics says that you cannot destroy or create energy, and the second law describes where the energy goes.

Now when this is applied to the intelligent design debate, we see that when energy has a way of spreading out and becoming 'even', this is exactly the opposite to what we would expect for intelligence. We can look at life and see the complexity of DNA, proteins, lipids, carbohydrates, signal molecules, etc. Nobody argues about that. Trying to explain how that complexity came there seems to be exactly the opposite to what we would expect based on the SLT2.

There is actually nothing in the SLT2 that says that complex life could not come by naturally occurring forces (as opposed to a designer), but that it isn't what one would expect, given that we generally don't see rocks rolling uphill, or divers plunging 10 meters upwards.


As it was explained to me by physicists, although energy has a way of "spreading out and becoming even", systems that have energy coming into them can increase in complexity.

So, as long as there were some kind of nearby energy source, like a star or something, couldn't a system could increase its complexity without violating SLT2, and without any rocks rolling uphill?

I agree that, as a tendency, energy tends to "spread out", just as an object at rest tends to stay at rest. But if a force is applied to the object (or energy is introduced into a system), it won't stay at rest (or necessarily spread out evenly).

So, although I agree that there is nothing in thermodynamics that precludes evolution (or God(s), either), I'm not on board with your "rocks rolling uphill" comparison. It just seems to me that, on the road to spreading out, energy and complexity can congregate in little clusters, especially if energy is being added to the system, and that is not as unlikely as a diver plunging upwards.

Of course, if energy were being added to the system, in the form of some kind of work, things can go uphill and plunge up out of water all the time...

I think you hedge your bets... I'm pretty sure you argued 'dating' techniques were way out, last time...

Origins of our species? Evolved or artifact?

I don't recall saying that the radio dating techniques were out. I do recall saying that the technique was based on assumptions (within the method) and that it is unwise to prove an old earth using assumptions.


Origin of species?

My faith has it that God is the origin of species, regardless of whether he used natural forces or supernatural ones, i.e. that he created, either directly or indirectly. Science cannot prove either way. Many people conclude that the species came about through natural means, but I have concluded that they have not. Empirical science does not come down on either side of the argument. It can show us microevolution, but not macroevolution. Thus it is only a clash of conclusions, not a clash of science versus faith. Therefore, I think that my faith is not at odds with science. It is at odds with popular opinion, perhaps, but not science.

I don't recall saying that the radio dating techniques were out. I do recall saying that the technique was based on assumptions (within the method) and that it is unwise to prove an old earth using assumptions.


Origin of species?

My faith has it that God is the origin of species, regardless of whether he used natural forces or supernatural ones, i.e. that he created, either directly or indirectly. Science cannot prove either way. Many people conclude that the species came about through natural means, but I have concluded that they have not. Empirical science does not come down on either side of the argument. It can show us microevolution, but not macroevolution. Thus it is only a clash of conclusions, not a clash of science versus faith. Therefore, I think that my faith is not at odds with science. It is at odds with popular opinion, perhaps, but not science.

'Empirical' science shows a strong suggestion that we evolved from 'lesser' ancestors, who, in turn, evolved from ancestors effectively indistinguishable from primates.

Do you contest that, in preference for a 'created whole, in god's image' assertion?

What is information in life, but a particular type of complexity?


Yes, you can put it that way, but keep in mind that randomness cannot generate information, if you define information as that which is specifically recognised and acted upon. Thus this would separate complexity (i.e. patterns on a sandy beach from the wind and waves) from specified information (e.g. gene sequences).



No, that's more like ATCGGCATCGATTTCCCGGGATGC


But you don't see anything like that in a rock crystal, which was my original example of complexity arising from non-directed forces.


Of course, polymer chemistry - spontaneously -can do the same thing, if you have four different monomers together. Add to that the fact that the monomers themselves conjugate to other monomers through hydrogen bonds, and you have a way to replicate them.


Yes, polymerisation can occur, to a limited extent, but this does not create information. The sequence would be determined by whichever nucleotide happened to be closest, and thus not result in specificity which can be recognised and acted upon (i.e. information). In fact, too much spontaneous polymerization is more likely to kill life than to create it.



So are most polymers. There are polymers that attach in an ABABAB fashion, but there are also polymers that would attach in a random fashion, much like DNA.


However life came about, it was almost certainly not through random polymerisation of DNA, since randomness does not generate information. I only say 'almost' in recognition that neither I nor anyone in the world knows all there is to know about chemistry and polymerisation. But the more we do know, the less likely it would seem.


Your information is derived from the order.


Information is a good deal more than mere order. And order does not create information, or at least not the non-symmetrical information that we see in DNA sequences.


It isn't information unless you are looking at it as such. A DNA or RNA molecule could form, absent any of the copying mechanisms. RNA, at least, could self-replicate, absent any of the enzymes that make the process more efficient.


The fact that it can self polymerise is more of a hindrance than a help, if you just think about it for a second.


You are calling it information because you know what it does. Being information, however, is not inherent in the structure of RNA or DNA, any more than a random string of numbers is inherently information.


I call it information when there is something that can recognise it as more than a jumbled sequence of nucleotides, when there is a message in the sequence.




By this statement, one can conclude that the SLT2 would not predict that life would not form.


It looks like you are not getting my point. I'll try to be plainer. My point is that the SLT2 does not address the ID/naturalistic debate, within its wording. It is the implications of SLT2 that some people (e.g. IDers) take to mean that complex information arising out of randomness through indiscriminate forces is unlikely, because it requires a focussing of energy, while SLT2 describes energy as 'spreading out'.


Oh wait. Now you say that the SLT2 predicts that this would not happen - which is the same thing as saying that it could not happen, according to the law.

Quite right. If we were to go with the most reliable horse, it would be more likely that information would not rise out of random forces.

'Empirical' science shows a strong suggestion that we evolved from 'lesser' ancestors, who, in turn, evolved from ancestors effectively indistinguishable from primates.

Do you contest that, in preference for a 'created whole, in god's image' assertion?

I would argue that empirical science does nothing of a sort. It shows that there is homology between our genes and (other) animals, for example, but it cannot say that we have evolved. That would be the conclusion, the 'educated guess', the opinion of the professor who thinks he cannot be so religious as to allow an alternative. He is basing his conclusion on the data supplied by empirical science, but I could take the same data and come to a completely different conclusion, without clashing with empirical science.

No part of my faith actually clashes with empirical science.

Thus when I propose that God made man in His image, my faith does not specify how He did it, only that he did indeed do it. It isn't necessary for my faith that I hold to a miraculous creation, but neither do I see the need to reach the same conclusions as most other scientists, particulary when I do not share their world view.

It shows that there is homology between our genes and (other) animals, for example, but it cannot say that we have evolved. That would be the conclusion, the 'educated guess', the opinion of the professor who thinks he cannot be so religious as to allow an alternative.

I'm sorry, I'm not sure I'm following you here. Are we saying to be religious, one necessarily has to have an alternative to evolution?

Can evolution itself, in its entirety, not fit into a religious premise? I'm not religious at all, but I don't consider it impossible that the process of macroevolution could be a tool of some kind of God.

I had thought some religious people, even some large mainstream churches, have said that they believe evolution is essentially correct. Unless one takes the most literal interpretation of scripture, I don't see that they have to be alternatives.

No part of my faith actually clashes with empirical science.

So your God is still creating a few stragglers then?

As it was explained to me by physicists, although energy has a way of "spreading out and becoming even", systems that have energy coming into them can increase in complexity.

Right, but we are not just talking about any old complexity, but information, a particular type of complexity that is not symmetric, and cannot be created by 'blind' forces.


So, as long as there were some kind of nearby energy source, like a star or something, couldn't a system could increase its complexity without violating SLT2, and without any rocks rolling uphill?


Are you suggesting that something like a sun could increase the complexity in the earth by heating it? I would have expected heat to decrease complexity.


I agree that, as a tendency, energy tends to "spread out", just as an object at rest tends to stay at rest. But if a force is applied to the object (or energy is introduced into a system), it won't stay at rest (or necessarily spread out evenly).

Of course, no argument there. We see this all the time. One could say that our bodies are fighting against SLT2 in order to keep us alive. I am not suggesting that there can be no forces at work against SLT2. The law describes an observed tendency in nature.


So, although I agree that there is nothing in thermodynamics that precludes evolution (or God(s), either), I'm not on board with your "rocks rolling uphill" comparison. It just seems to me that, on the road to spreading out, energy and complexity can congregate in little clusters, especially if energy is being added to the system, and that is not as unlikely as a diver plunging upwards.


Then I suppose my analogies failed to convey my thoughts precisely, since you are objecting to something that was not my original point. The 'uphill' that I was referring to was not mere complexity. This is easy to see, since when you freeze water, you increase complexity (ice crystals). But I was never really meaning mere complexity, but information, a particular type of complexity.



Of course, if energy were being added to the system, in the form of some kind of work, things can go uphill and plunge up out of water all the time...


Yes, but these analogies were supposed to show how difficult it is, e.g. rocks rolling uphill require a good deal of added energy. And creating information requires a good deal of both energy and guidance.

I would argue that empirical science does nothing of a sort. It shows that there is homology between our genes and (other) animals, for example, but it cannot say that we have evolved. That would be the conclusion, the 'educated guess', the opinion of the professor who thinks he cannot be so religious as to allow an alternative. He is basing his conclusion on the data supplied by empirical science, but I could take the same data and come to a completely different conclusion, without clashing with empirical science.

No part of my faith actually clashes with empirical science.

Thus when I propose that God made man in His image, my faith does not specify how He did it, only that he did indeed do it. It isn't necessary for my faith that I hold to a miraculous creation, but neither do I see the need to reach the same conclusions as most other scientists, particulary when I do not share their world view.

You are dodging the issue.

Did god make us as 'us', or did we evolve?

Stop prevaricating about the bush.


We can see 'empirical' mechanisms. We can see 'empirical' similarities. It is not illogical to assume that where there is similarity, there is either connection or parallel.

'Empirically', science favours the idea that we evolved from an evolutionary predecessor (original cause unknown and/or irrelevent).

The question is - do you follow the empirical chainof reasoning, or will you choose 'faith' over science?

Right, but we are not just talking about any old complexity, but information, a particular type of complexity that is not symmetric, and cannot be created by 'blind' forces.

Why's that, exactly?

Are you suggesting that something like a sun could increase the complexity in the earth by heating it? I would have expected heat to decrease complexity.

It's adding energy to the system.

Then I suppose my analogies failed to convey my thoughts precisely, since you are objecting to something that was not my original point. The 'uphill' that I was referring to was not mere complexity. This is easy to see, since when you freeze water, you increase complexity (ice crystals). But I was never really meaning mere complexity, but information, a particular type of complexity.

What makes it paticular? The fact something is there to understand it?

And creating information requires a good deal of both energy and guidance.

...Because?

I'm sorry, I'm not sure I'm following you here. Are we saying to be religious, one necessarily has to have an alternative to evolution?


No, I was actually saying the opposite. In my little insignificant opinion (I don't speak for Christianity), I am saying that religion need not reject macroevolution. I am also saying that it need not embrace it either.


Can evolution itself, in its entirety, not fit into a religious premise? I'm not religious at all, but I don't consider it impossible that the process of macroevolution could be a tool of some kind of God.

Of course God is capable of using natural forces. Haven't you been reading my posts?


I had thought some religious people, even some large mainstream churches, have said that they believe evolution is essentially correct. Unless one takes the most literal interpretation of scripture, I don't see that they have to be alternatives.


My position is that of preferring open (unanswered) questions than the narrow and exclusive assumptions of naturalism (i.e. that there was not interferrence from God). In other words, I would rather live with open questions than embraced obviously flawed theories. I would rather follow the truth where I find it, than make assumptions that are unnecessary.

...the narrow and exclusive assumptions of naturalism (i.e. that there was not interferrence from God)...

Now I remember....Where exactly in the theory is "God didn't do it"?

Right, but we are not just talking about any old complexity, but information, a particular type of complexity that is not symmetric, and cannot be created by 'blind' forces.


Some mathematicians take the view that the special value we give to "order" and "complexity" are synthetic, and that "information" is just order that we've given a meaning to. Not all feel that way, though.


Are you suggesting that something like a sun could increase the complexity in the earth by heating it? I would have expected heat to decrease complexity.


Well, I don't think its just the heating, Bruarong. I'm pretty sure that the sun provides energy that is used in biological processes, including the synthesis of various increasingly complex chemicals.


Of course, no argument there. We see this all the time. One could say that our bodies are fighting against SLT2 in order to keep us alive. I am not suggesting that there can be no forces at work against SLT2. The law describes an observed tendency in nature.

Then I suppose my analogies failed to convey my thoughts precisely, since you are objecting to something that was not my original point. The 'uphill' that I was referring to was not mere complexity. This is easy to see, since when you freeze water, you increase complexity (ice crystals). But I was never really meaning mere complexity, but information, a particular type of complexity.

Yes, but these analogies were supposed to show how difficult it is, e.g. rocks rolling uphill require a good deal of added energy. And creating information requires a good deal of both energy and guidance.

I see the "energy" part, just not necessarily the guidance. A geothermic event could blast rocks uphill, or spew something up out of the water, and if it forms thousands of images, one of which looks like a smily face, I don't think that's "guidance" per se.

You are dodging the issue.

Did god make us as 'us', or did we evolve?

Stop prevaricating about the bush.


What part don't you get? God did make us, either through a miracle or through evolution. Science cannot prove evolution, neither can it disprove miracles.


We can see 'empirical' mechanisms. We can see 'empirical' similarities. It is not illogical to assume that where there is similarity, there is either connection or parallel.


I have never called evolution illogical. Just not proven, and in some cases, apparently unlikely, and even flawed.


'Empirically', science favours the idea that we evolved from an evolutionary predecessor (original cause unknown and/or irrelevent).


I argue that empirical science does nothing of a sort. It works at the level of observation and repetition. It is the human component of science that makes the conclusions, not the empirical science part.


The question is - do you follow the empirical chainof reasoning, or will you choose 'faith' over science?


I like to think that my faith is composed of the same sort of reasoning that I use in science, i.e. that it is supposed to be reasonable. Thus, my faith does not clash with reason. I can say that it really only clashes with naturalistic thinking, a relatively modern development within science.

I suppose I should define naturalism: the concept that only natural forces were involved in the 'creation' of life, development of the species, existance of man, etc.

the concept that only natural forces were involved in the 'creation' of life, development of the species, existance of man, etc.

Which is suprisingly hard to find in the theory of evolution.

No, I was actually saying the opposite. In my little insignificant opinion (I don't speak for Christianity), I am saying that religion need not reject macroevolution. I am also saying that it need not embrace it either.

Of course God is capable of using natural forces. Haven't you been reading my posts?

Yes, and I'm very sorry I'm not completely understanding you. You said this:

It shows that there is homology between our genes and (other) animals, for example, but it cannot say that we have evolved. That would be the conclusion, the 'educated guess', the opinion of the professor who thinks he cannot be so religious as to allow an alternative.


and evidently I took it wrong. Sorry, but I am trying.


My position is that of preferring open (unanswered) questions than the narrow and exclusive assumptions of naturalism (i.e. that there was not interferrence from God).

But you've said science doesn't come down either way, in favor or against God (which I agree it doesn't). By "preferring" upon your God, are you not making your own assumptions? Why is your belief that God did interfere less "narrow and exclusive" that somebody who thinks he didn't?

In other words, I would rather live with open questions than embraced obviously flawed theories. I would rather follow the truth where I find it, than make assumptions that are unnecessary.

So, is your God an open question? Is he the "found truth" or an assumption?

Some mathematicians take the view that the special value we give to "order" and "complexity" are synthetic, and that "information" is just order that we've given a meaning to. Not all feel that way, though.

OK But by information, I don't necessarily mean that which I can assign meaning to, but that which can be recognised as having meaning, i.e., it's not important what I can or cannot recognise, but if it 'works' for a life form, whether I can recognise it or not.


Well, I don't think its just the heating, Bruarong. I'm pretty sure that the sun provides energy that is used in biological processes, including the synthesis of various increasingly complex chemicals.


Aha, but now you have already got the information systems already in place, harnessing the energy of the sun. Information and life force working together can work well against the SLT, but what about if you take away the life and the information. Can you picture a situation where heating might produce information?


I see the "energy" part, just not necessarily the guidance. A geothermic event could blast rocks uphill, or spew something up out of the water, and if it forms thousands of images, one of which looks like a smily face, I don't think that's "guidance" per se.

*Chuckles* When was the last time you say a smiley face in a bomb blast? If you did, you were probably too close to it.

I suppose I'm trying to see it from the point of view of what I know about life. I sometimes picture myself the size of a nucleotide, and try to imagine the spontaneous polymerization and the recognition of this 'random' sequence of RNA or DNA as somehow meaning something that happens to make life possible. This is the level of information that we are looking for. This is not just a smiley face. This is deep at the source of life itself.

God did make us, either through a miracle or through evolution.

Its possible that this statement might include some assumptions.

I don't preclude it as a possibility, but I don't think it can be presented as fact at his time.

What part don't you get? God did make us, either through a miracle or through evolution. Science cannot prove evolution, neither can it disprove miracles.


Still, you avoid a direct answer.


I have never called evolution illogical. Just not proven, and in some cases, apparently unlikely, and even flawed.


Of course it isn't 'proven'... that is First Grade stuff... you can never 'prove' anything with science.

However... despite your not liking it, the 'logical' premise is that we follow those same kind of mechanisms we theorise. There is certainly much more 'evidence' for 'evolution' than there is for a 'divine creation'.


I argue that empirical science does nothing of a sort. It works at the level of observation and repetition. It is the human component of science that makes the conclusions, not the empirical science part.


And, I argue that you are wrong. Empirical science observes and repeats, yes... but it is also the conduit through which the theory is distilled and refined. Empirically, science favours evolution.


I like to think that my faith is composed of the same sort of reasoning that I use in science, i.e. that it is supposed to be reasonable. Thus, my faith does not clash with reason. I can say that it really only clashes with naturalistic thinking, a relatively modern development within science.


You can 'like to think' that all you like, but the very instant you base one of your assumptions on an article of faith, you make a liar of it.


I suppose I should define naturalism: the concept that only natural forces were involved in the 'creation' of life, development of the species, existance of man, etc.

Which is irrelevent to science.

Which is suprisingly hard to find in the theory of evolution.

That's is to say that you have not found it? I am mildly surprised. How widely read on the theory are you? (I don't mean that as an insult.)

I suppose I'm trying to see it from the point of view of what I know about life. I sometimes picture myself the size of a nucleotide, and try to imagine the spontaneous polymerization and the recognition of this 'random' sequence of RNA or DNA as somehow meaning something that happens to make life possible. This is the level of information that we are looking for. This is not just a smiley face. This is deep at the source of life itself.

What makes you think life has so much meaning?

*Chuckles* When was the last time you say a smiley face in a bomb blast? If you did, you were probably too close to it.


I've seen 'a skull' in an explosion...

I think the question has to by, why do we define the possibility of information, by symbols comprehesible to US?

That's is to say that you have not found it? I am mildly surprised. How widely read on the theory are you? (I don't mean that as an insult.)

Perhaps not much, but near as I can tell it involves organisms being different, and better ones having more kids. Maybe there's something you can direct me to where this rules out unnatural forces?

Yes, and I'm very sorry I'm not completely understanding you. You said this:



and evidently I took it wrong. Sorry, but I am trying.


You are a polite chap.


But you've said science doesn't come down either way, in favor or against God (which I agree it doesn't). By "preferring" upon your God, are you not making your own assumptions? Why is your belief that God did interfere less "narrow and exclusive" that somebody who thinks he didn't?


The naturalist assumes that everything can be explained using natural forces. I think that much can be explained using natural forces, but much cannot. I allow for more than natural forces. The naturalist does not. Therefore, his view is more narrow than mine, since he is ruling out the interference of God (even while he knows that he cannot prove this), and I am allowing for both natural causes and God.


So, is your God an open question? Is he the "found truth" or an assumption?


For me, He is definitley a 'found truth', no question. It would be dishonest of me to say that I think it is possible that he does not exist. It might be advantagous, if I was trying to win a debate, but not honest.

I don't recall saying that the radio dating techniques were out. I do recall saying that the technique was based on assumptions (within the method) and that it is unwise to prove an old earth using assumptions.

You said the techniques were flawed and unreliable. What do you think that means? This hemming and hawing is tiresome.

http://forums.jolt.co.uk/showpost.php?p=10416757&postcount=298
I don't think the world looks millions of years old.
I know that there is a lot of speculation based on this. I have had a look at some radioactive dating systems, and my conclusion is that they only work if the world is millions of years old. If it isn't, most of them simply do not work. Do you see the fix? They only work if the assumption is true.

Of course, this ignores the fact that we can test the radioactive decay rates and show that using various methods of calibration see that it is effective on the macro level, but, hey, you're not starting with your conclusion in hand are you? You argue that science started with conclusion in hand, but considering the dating technique is relatively new (in the realm of human history) and had to be demonstrated through testing first, that seems a bit silly.

You argue the same way about evolution, with vague references to the assumptions it doesn't make. However, not long ago people were physically fighting over evolution. It had to fight a very uphill battle in order to be accempted in a primarily Christian scientific community. It's amusing that one would argue that science supports naturalism when so few scientists are naturalists.

OK But by information, I don't necessarily mean that which I can assign meaning to, but that which can be recognised as having meaning, i.e., it's not important what I can or cannot recognise, but if it 'works' for a life form, whether I can recognise it or not.

Some cognitive researchers suggest there may be no difference, here.


Aha, but now you have already got the information systems already in place, harnessing the energy of the sun. Information and life force working together can work well against the SLT, but what about if you take away the life and the information. Can you picture a situation where heating might produce information?

Easily. Take particles in some form, heat them to motive agitation and let them come to rest. Repeat until you find something that "works for life", or something that you find meaning in.


*Chuckles* When was the last time you say a smiley face in a bomb blast? If you did, you were probably too close to it.

When was the last time you saw recognizable images in clouds or tree bark? I see them all the time. You're committed to the idea that information has to be "guided". What sentient entity wanted me to find a peanut shell that looked like Richard Nixon? Maybe I just saw Nixon, and I assigned the meaning. Maybe that's what meaning is.


I suppose I'm trying to see it from the point of view of what I know about life. I sometimes picture myself the size of a nucleotide, and try to imagine the spontaneous polymerization and the recognition of this 'random' sequence of RNA or DNA as somehow meaning something that happens to make life possible. This is the level of information that we are looking for. This is not just a smiley face. This is deep at the source of life itself.

As I've said in the past, this need to assign some deep meaning seems to be at the core of most people's religious assumptions.

Would it be pretty remarkable for such comlexity to arise randomly and be selected for? Sure. But not as remarkable as talking flaming bushes or Gods demanding the blood of their "good" child to assuage their anger over the nature of their "bad" children.

You are a polite chap.

The naturalist assumes that everything can be explained using natural forces. I think that much can be explained using natural forces, but much cannot. I allow for more than natural forces. The naturalist does not. Therefore, his view is more narrow than mine, since he is ruling out the interference of God (even while he knows that he cannot prove this), and I am allowing for both natural causes and God.

But don't you believe that natural forces arise from the creative will of God?
You are not allowing for a process without God (or uninterfered with by God), and this is very much as narrow as a scientist who doesn't allow for at least a kind of God (but not necessarily believing in one).

I'm sorry, Bruarong, I'm not trying to be combative, but do you see where you're having it both ways?

You want to dismiss the other side, while claiming that they are being narrow.

They observe natural causes, don't observe God, so they go with the natural (while hopefully not precluding or dismissing God, but not assumptively including him either). You observe the natural, and include God as your assumption, "no question". I don't think you're being fair when you call them narrow.


For me, He is definitley a 'found truth', no question. It would be dishonest of me to say that I think it is possible that he does not exist. It might be advantagous, if I was trying to win a debate, but not honest.

Forget the debate, there's no money on the "winner". But why is it okay for you to declare your God a "found truth, no question" after admitting that science doesn't come down either way, but scientists who don't share your assumption are the narrow ones?

Bruarong, is it possible you might also be narrow in a way?

You are a polite chap.



The naturalist assumes that everything can be explained using natural forces.

That is not what naturalism claims. It claims that everything happens only using natural forces. There is a difference. Science is not naturalist but it does only accept natural (read: evidenced) explanations.

I think that much can be explained using natural forces, but much cannot. I allow for more than natural forces. The naturalist does not. Therefore, his view is more narrow than mine, since he is ruling out the interference of God (even while he knows that he cannot prove this), and I am allowing for both natural causes and God.

Ah, there you go. "The naturalist does not." That's the point. You misstated when you described naturalism in the earlier paragraph. An explanation that does not include the supernatural for practical purposes does not exclude the possiblity of the supernatural.

So you allow as one of the possible existences of the universe that God played no part in it whatsoever?

For me, He is definitley a 'found truth', no question. It would be dishonest of me to say that I think it is possible that he does not exist. It might be advantagous, if I was trying to win a debate, but not honest.
In other words, you don't allow for both. You allow for only the explanation that includes God in the workings of the world. In fact, you've argued that he must be able to interfere in the world or else he can't forgive our sins (a ridiculous conclusion, but you argued it nonetheless). In order to be truly open-minded you have to accept the possiblity that God never has interfered in the world. You have openly stated that you don't accept this possibility and saying that no involvement can have occurred is just as close-minded as saying some involvement MUST have occurred.

I find it amusing that in each thread you make more and more of an effort to pretend like your analysis in this subject is objective and simply looking for truth. All evidence supports that you start with truth in hand and deny all that you believe goes against your 'truth'. Why pretend otherwise?

I'm sorry, I have to run.

@Bruarong: Bru, I respect you, as a scientist and a person. I'm sorry if I come off as attacking, and I will come back and read your reply.

@Jocabia: Jo, I want to thank you. Encounters with you have taught me to try to be less biased against religion, and even though I'm sure we disagree on much, I feel that the character of my interaction in these threads has been improved by interacting with you.

Perhaps not much, but near as I can tell it involves organisms being different, and better ones having more kids. Maybe there's something you can direct me to where this rules out unnatural forces?

It was the whole argument of Dawin and his 'bulldog', Huxley. They argued that any scientist that allowed supernatural causes to explain something in the material world was no *real* scientist. That obviously upset a lot of people back then.

What you referred to is not evolution, but natural selection. No one denies natural selection. I doubt anyone who knows something about science denies natural selection or any of the common processes we see in microevolution, such as variability, selection and isolation, speciation, etc. I certainly see these processes in nature, so I would never argue against them. They may have even been used by God to create Adam, but I don't find that very likely, based on what I have understood thus far of the theory.

The whole difference I have with evolutionary theory is where someone clings to natural forces as the only forces that could have possible contributed to development. If you read up enough of evolutionary theory, you might not find this spelled out directly, but you will see a complete absense of God, even when there is no sensible alternative. It would be because the writer is unwilling to allow for God, even if he believes in God's existence, because he feels that it would no longer be science if he did--just as Darwin insisted all those years ago.

Yes, you can put it that way, but keep in mind that randomness cannot generate information, if you define information as that which is specifically recognised and acted upon.

Sure it can. When I shuffle a deck of cards - I am doing something randomly. However, I specifically recognize and act upon the patterns that I am randomly dealt.

You are trying to do things backwards, assuming that the method of recognizing the pattern has to exist before the pattern does. In truth, one cannot use a pattern for information until that pattern has been formed. Only then can a "use" be found for it.

Thus this would separate complexity (i.e. patterns on a sandy beach from the wind and waves) from specified information (e.g. gene sequences).

If I developed a computer that ran a program based on patterns on a beach, would the patterns suddenly become information? Or were they always simply patterns, and now I am using them as information?

But you don't see anything like that in a rock crystal, which was my original example of complexity arising from non-directed forces.

Irrelevant. You see something exactly like that in polymer chemistry. You can't take one specific form of order and expect all spontaneously arising order to look exactly like it.

Yes, polymerisation can occur, to a limited extent, but this does not create information.

Of course it does. It may not be information that would do anything that we would recognize, but it is information just as surely as information in an actual gene is.

In fact, too much spontaneous polymerization is more likely to kill life than to create it.

Once life is established, this is true. Hence the need for controls - and the use of DNA, rather than RNA for coding the genome.

However life came about, it was almost certainly not through random polymerisation of DNA,

No, it was most likley RNA, at least at first.

since randomness does not generate information.

You keep saying this. I'd like to see you back it up.

Information is a good deal more than mere order.

Yes, it is order that has a significance attached to it - a "translation" of sorts attached to it.

The fact that it can self polymerise is more of a hindrance than a help, if you just think about it for a second.

We aren't talking about the here and now, my dear. We are talking about something that may have occurred before complex lifeforms. In complex lifeforms, it would be a problem, just as too much mutation becomes a problem. But as a possibility for the origin of life, self-polymerization would be much more likely to lead to "information".

I call it information when there is something that can recognise it as more than a jumbled sequence of nucleotides, when there is a message in the sequence.

Any sequence has a message that can be read, even if it is nothing more than a series of stop and start codons. Information is not inherent in the code - it is derived by the use of the code.

It looks like you are not getting my point. I'll try to be plainer. My point is that the SLT2 does not address the ID/naturalistic debate, within its wording.

Of course it doesn't. But you are trying to claim that it predicts that evolution would not have occurred. By claiming that, you are either claiming that evolution is wrong or that the SLT2 is wrong. If a theory's predictions are incorrect, it is an incorrect theory.

It is the implications of SLT2 that some people (e.g. IDers) take to mean that complex information arising out of randomness through indiscriminate forces is unlikely, because it requires a focussing of energy, while SLT2 describes energy as 'spreading out'.

And herein you say the exact same thing you've been saying - and it is no less wrong. SLT2 does not in any way suggest that there will not be focusing of energy - and we see such focusing throughout the natural world all the time. To suggest that the one type of "focusing" you don't personally like contradicts the predictions of SLT2 is to demonstrate your own extreme bias.

Quite right. If we were to go with the most reliable horse, it would be more likely that information would not rise out of random forces.

You can believe that all you like, but there is nothing in the SLT2 or in the empirical evidence to suggest it.

What part don't you get? God did make us, either through a miracle or through evolution. Science cannot prove evolution, neither can it disprove miracles.

Proof is for mathematics and alcohol. You claim to be a scientist, yet you don't seem to grasp that concept. Where'd you get your degree? Patriot University?

Are you suggesting that something like a sun could increase the complexity in the earth by heating it? I would have expected heat to decrease complexity.

Another demonstration of your misunderstanding of thermodynamics. Often, when heat is given off by a system, that system is increasing the entropy in its surroundings. When heat is added to a system, on the other hand, we are adding energy to the system, which can lead to a decrease in entropy.

Of course, no argument there. We see this all the time. One could say that our bodies are fighting against SLT2 in order to keep us alive. I am not suggesting that there can be no forces at work against SLT2. The law describes an observed tendency in nature.

If there are "forces at work against SLT2", then the theory itself is incorrect, as it claims to apply to all processes. It describes a tendency in nature that we have never observed a violation of. If we observe such a violation, the law will be discarded.

It was the whole argument of Dawin and his 'bulldog', Huxley. They argued that any scientist that allowed supernatural causes to explain something in the material world was no *real* scientist. That obviously upset a lot of people back then.

What you referred to is not evolution, but natural selection. No one denies natural selection. I doubt anyone who knows something about science denies natural selection or any of the common processes we see in microevolution, such as variability, selection and isolation, speciation, etc. I certainly see these processes in nature, so I would never argue against them. They may have even been used by God to create Adam, but I don't find that very likely, based on what I have understood thus far of the theory.

The whole difference I have with evolutionary theory is where someone clings to natural forces as the only forces that could have possible contributed to development. If you read up enough of evolutionary theory, you might not find this spelled out directly, but you will see a complete absense of God, even when there is no sensible alternative. It would be because the writer is unwilling to allow for God, even if he believes in God's existence, because he feels that it would no longer be science if he did--just as Darwin insisted all those years ago.

Well, it wouldn't. Science isn't capable of adressing the supernatural. and as for evolution, looking at new species, ring species, and not arbitrarily dividing it into "micro-" and "macro-" evolution, natural selection is all it needs. If maybe your talking about the absence of meaning it gives you, *shrug* there doesn't seem to be much reason to think we've a meaning.

Easily. Take particles in some form, heat them to motive agitation and let them come to rest. Repeat until you find something that "works for life", or something that you find meaning in.

Personally, I can imagine complexity arising out of such a situation, perhaps, but not the sort of complexity that would be sufficient for information systems. Because information, as we see it in nature, is not symmetrical (mostly).
Futhermore, it cannot be selected, since 'selected' implies a deliberate action. If we are talking about abiogenesis, this is not an option.




When was the last time you saw recognizable images in clouds or tree bark? I see them all the time. You're committed to the idea that information has to be "guided". What sentient entity wanted me to find a peanut shell that looked like Richard Nixon? Maybe I just saw Nixon, and I assigned the meaning. Maybe that's what meaning is.


By meaning, I am not referring to the meaning of life, but the meaning of a sequence of nucleotides that codes for e.g., a DNA ligase.


As I've said in the past, this need to assign some deep meaning seems to be at the core of most people's religious assumptions.


You have the wrong meaning of my use of the word 'meaning'.


Would it be pretty remarkable for such comlexity to arise randomly and be selected for? Sure. But not as remarkable as talking flaming bushes or Gods demanding the blood of their "good" child to assuage their anger over the nature of their "bad" children.

That is just comparing biases.

They argued that any scientist that allowed supernatural causes to explain something in the material world was no *real* scientist. That obviously upset a lot of people back then.

But why is it any more okay to assume supernatural forces than to assume only natural forces? What if they had used supernatural explanations, rather than continuing to seek natural ones?

There might be supernatural forces, but they can't be tested for if they are truly supernatural, so why is it fair for you to state them as "definite truth"?


The whole difference I have with evolutionary theory is where someone clings to natural forces as the only forces that could have possible contributed to development.

Why is continuing to seek natural explanations (since its hard to address the supernatural areas with science) any worse than you declaring that supernatural forces are truth, "no question"? Isn't that a kind of clinging?

After all, if a God is real, natural forces are likely just some expression of that God, set in place and governed by such. So, to say that you allow for both (while definitely including God) doesn't really mean you see both sides.

You choosing the side that definitely includes God is a very similar mentality to the ones that definitely exclude it.

Personally, I can imagine complexity arising out of such a situation, perhaps, but not the sort of complexity that would be sufficient for information systems. Because information, as we see it in nature, is not symmetrical (mostly).
Futhermore, it cannot be selected, since 'selected' implies a deliberate action. If we are talking about abiogenesis, this is not an option.

In biology, selected does not imply a deliberate action. You claim this often, but it's patently false. 'Selected' in biology refers to natural forces causing one outcome to be successful (which simply means to persist). You use lay terms in lay ways to argue scientific points. It makes me questions your claims about your expertise. When coupled with your 'ape' ancestor arguments, one has to argue how educated you actually are on this subject.


By meaning, I am not referring to the meaning of life, but the meaning of a sequence of nucleotides that codes for e.g., a DNA ligase.

Or the 'meaning' of the physics laws themselves. Or the 'meaning' of gravity. Certainly every thing that exists can be ascribed a form of organization or meaning because within the realm in which they are analyzed they cause things to occur in a very specific way.

You have the wrong meaning of my use of the word 'meaning'.

Amusing. I like that wording. However, you are actually using meaning in the same way. If you are simply talking about controlling an event then you could say that about any number of things having nothing to do with life.

That is just comparing biases.
I believe that's the point.

Futhermore, it cannot be selected, since 'selected' implies a deliberate action. If we are talking about abiogenesis, this is not an option.


Strawman.

You define how you want 'selected' to be understood, so that it can fail by those rules?

If a round hole is left in a surface, and a square object fails to fall through it - you could argue the surface is 'selective'.

There is no need to assume 'deliberate action'.

It was the whole argument of Dawin and his 'bulldog', Huxley. They argued that any scientist that allowed supernatural causes to explain something in the material world was no *real* scientist. That obviously upset a lot of people back then.

What you referred to is not evolution, but natural selection. No one denies natural selection. I doubt anyone who knows something about science denies natural selection or any of the common processes we see in microevolution, such as variability, selection and isolation, speciation, etc. I certainly see these processes in nature, so I would never argue against them. They may have even been used by God to create Adam, but I don't find that very likely, based on what I have understood thus far of the theory.

The whole difference I have with evolutionary theory is where someone clings to natural forces as the only forces that could have possible contributed to development. If you read up enough of evolutionary theory, you might not find this spelled out directly, but you will see a complete absense of God, even when there is no sensible alternative. It would be because the writer is unwilling to allow for God, even if he believes in God's existence, because he feels that it would no longer be science if he did--just as Darwin insisted all those years ago.
There is a complete absense of God because it is not something suggested by the evidence and it is not a testable part of the theory. Your argument is for a God of the gaps. No explanation? Throw God in there to fill it in. The writer is not unwilling to allow for God, there is simply no evidence that makes God an element of his/her paper. When I write a paper, I don't present Big Foot at all. Does that mean every paper I produce is an argument against Big Foot? Or perhaps since Big Foot has no place and offers no improvement in my scientific papers, I simply leave him/her out.

There is a complete absense of God because it is not something suggested by the evidence and it is not a testable part of the theory. Your argument is for a God of the gaps. No explanation? Throw God in there to fill it in. The writer is not unwilling to allow for God, there is simply no evidence that makes God an element of his/her paper. When I write a paper, I don't present Big Foot at all. Does that mean every paper I produce is an argument against Big Foot? Or perhaps since Big Foot has no place and offers no improvement in my scientific papers, I simply leave him/her out.

Exactly... it's like asking why "Quack" isn't one of the options on my "List of Numbers Between One and Ten"...

But why is it any more okay to assume supernatural forces than to assume only natural forces? What if they had used supernatural explanations, rather than continuing to seek natural ones?

There might be supernatural forces, but they can't be tested for if they are truly supernatural, so why is it fair for you to state them as "definite truth"?

I would like to point here that Bruarong has openly said that once supernatural causes are assumed that it makes sense to not fund or continue to look for a natural explanation. He is quite literally arguing that people should assume God did it if they cannot find a better explanation and then quit looking.

But don't you believe that natural forces arise from the creative will of God?
You are not allowing for a process without God (or uninterfered with by God), and this is very much as narrow as a scientist who doesn't allow for at least a kind of God (but not necessarily believing in one).


On the other hand, I have been allowing for natural processes accomplishing God's purposes. It see this all the time. In other words, I think God uses both natural processes and miraculous ones. The natural process would appear to be one that God does not interfer with, but it accomplishes his purposes anyway.


I'm sorry, Bruarong, I'm not trying to be combative, but do you see where you're having it both ways?

You want to dismiss the other side, while claiming that they are being narrow.


They are narrower, simply because they have one less option. But I don't dismiss the other side. I simply disagree with them.


They observe natural causes, don't observe God, so they go with the natural (while hopefully not precluding or dismissing God, but not assumptively including him either). You observe the natural, and include God as your assumption, "no question". I don't think you're being fair when you call them narrow.


I have been saying that they *do* preclude God. They rule him out.
(I get the distinct feeling that you are misreading my posts when I have to repeat myself so often, SC. I'm sure you don't intend to do that, but it sure looks that way.)

I, on the other hand, do not assume either a miracle or a natural force, but allow for both. They have one less option than me.


Forget the debate, there's no money on the "winner". But why is it okay for you to declare your God a "found truth, no question" after admitting that science doesn't come down either way, but scientists who don't share your assumption are the narrow ones?

Because my declaration is based on personal evidence, the sort that I cannot use to convince you or anyone else. In science, on the other hand, you have to be able to support every assertion and conclusion with public evidence and a reasonable argument. That's the difference between a personal conviction and science.


Bruarong, is it possible you might also be narrow in a way?

I suppose you could say that. I know my mother, and you don't. Therefore, since I insist that she exists (although I cannot prove it to you), you might think me narrow, and you might be right. But my 'narrowness' is based on my personal evidence of God, while the 'narrowness' of naturalism is based on an assumption.

I would like to point here that Bruarong has openly said that once supernatural causes are assumed that it makes sense to not fund or continue to look for a natural explanation. He is quite literally arguing that people should assume God did it if they cannot find a better explanation and then quit looking.
Actually I think he's saying look all you want until you eyes pop out. He's confident in his knowledge that god played a role in our creation and doesn't need to keep looking.

Exactly... it's like asking why "Quack" isn't one of the options on my "List of Numbers Between One and Ten"...

Well, to be fair, since he is arguing that God was a factor in evolution, your analogy isn't really apt. What it's like arguing is that if I were asked to describe a box I admitted I am unable to open and I didn't guess at the contents because I was unable to analyze them, then I must be denying the possiblity of contents. I can only describe the charactistics of the box that are available to my discipline. Asking for anything else is to ask for uneducated guessing.

What part don't you get? God did make us, either through a miracle or through evolution.

What makes you think it is either miracle or evolution?
Can evolution itself not be seen as a miracle if caused by God?
Is it not possible that some other mechanism, as yet undiscovered, caused our species to arise on Earth?

I can say that it really only clashes with naturalistic thinking, a relatively modern development within science.

"Naturalism" as you define it, has nothing whatsoever to do with science. The vast majority of scientists are religious people who believe in a Creator. They just recognize what you often fail to - that the methods of science are only valid within nature. Nothing about any scientific theory precludes the involvement of God. It simply cannot and will not assume it.

The naturalist assumes that everything can be explained using natural forces. I think that much can be explained using natural forces, but much cannot. I allow for more than natural forces. The naturalist does not. Therefore, his view is more narrow than mine, since he is ruling out the interference of God (even while he knows that he cannot prove this), and I am allowing for both natural causes and God.

Once again, this has nothing to do with science. Most scientists are not naturalists, by this definition. However, scientists do recognize that they can only use science to study that which can be explained by natural forces. Outside of that, another method (such as theology, other forms of philosophy, etc.) must be used.

It was the whole argument of Dawin and his 'bulldog', Huxley. They argued that any scientist that allowed supernatural causes to explain something in the material world was no *real* scientist. That obviously upset a lot of people back then.

If a scientist uses the supernatural in a scientific explanation, they are not scientists. If a scientist believes that the supernatural exists, and is is involved in a process in some way, then said scientist believes he cannot study that process with science, and must look at it with another field of study.

What you referred to is not evolution, but natural selection. No one denies natural selection. I doubt anyone who knows something about science denies natural selection or any of the common processes we see in microevolution, such as variability, selection and isolation, speciation, etc. I certainly see these processes in nature, so I would never argue against them.

You have argued against speciation quite a bit - not to mention that those who split evolutionary theory into "microevolution" and "macroevolution" use speciation as the point for "macroevolution". Thus, if you acknowledge that speciation occurs through natural selection, you have accepted "macroevolution".

The whole difference I have with evolutionary theory is where someone clings to natural forces as the only forces that could have possible contributed to development. If you read up enough of evolutionary theory, you might not find this spelled out directly, but you will see a complete absense of God, even when there is no sensible alternative.

Does it bother you that no one has yet included God in theories on black holes or quantum mechanics (you want to talk about some weird stuff with no clear explanation)? Scientific theories cannot inject God, as God is an untestable and unfalsifiable assumption. So, yes, you will see an absence of God in evolutionary theory, just as you see an absence of God in thermodynamics, physics, chemistry, etc. That does not, however, suggest that there are only natural forces. It simply means that we only use science to study natural forces.

It would be because the writer is unwilling to allow for God, even if he believes in God's existence, because he feels that it would no longer be science if he did--just as Darwin insisted all those years ago.

It is the very method of science that does not allow for God to be used in a scientific explanation. Unless, that is, you have a way to falsify God?


Personally, I can imagine complexity arising out of such a situation, perhaps, but not the sort of complexity that would be sufficient for information systems. Because information, as we see it in nature, is not symmetrical (mostly).
Futhermore, it cannot be selected, since 'selected' implies a deliberate action. If we are talking about abiogenesis, this is not an option.

You should talk to John Doyle at CalTech. Interesting guy. Mathmetician. Has quite a bit to say about the various forms of complexity that arise out of chaos.

Actually I think he's saying look all you want until you eyes pop out. He's confident in his knowledge that god played a role in our creation and doesn't need to keep looking.

No, in another thread, he suggested that it should not be funded, nor should any looking continue to occur. He suggested that continuing to look is operating on an assumption that God does not exist.

Well, to be fair, since he is arguing that God was a factor in evolution, your analogy isn't really apt. What it's like arguing is that if I were asked to describe a box I admitted I am unable to open and I didn't guess at the contents because I was unable to analyze them, then I must be denying the possiblity of contents. I can only describe the charactistics of the box that are available to my discipline. Asking for anything else is to ask for uneducated guessing.
but in your analogy "uneducated guessing" is just that, uneducated

They are narrower, simply because they have one less option.


This is not true...

They have at LEAST as many options (most likely more... since I know for a fact you don't believe ALL religious answers to be equal)... they just don't construct their calculations around any assumption that cannot be verified...

You said the techniques were flawed and unreliable. What do you think that means? This hemming and hawing is tiresome.

http://forums.jolt.co.uk/showpost.php?p=10416757&postcount=298



Jocabia? Your back? I thought you were leaving NS? Didn't you start a thread about that?

As for your impressive research on that past discussion on radioactive dating, I did not find the words 'flawed' and 'unreliable' in my original post. I simply said that the method is based on an assumption, and that it is not wise to use an assumption to prove a point.


Of course, this ignores the fact that we can test the radioactive decay rates and show that using various methods of calibration see that it is effective on the macro level, but, hey, you're not starting with your conclusion in hand are you? You argue that science started with conclusion in hand, but considering the dating technique is relatively new (in the realm of human history) and had to be demonstrated through testing first, that seems a bit silly.


I think you are attacking a point that I never made. I never said that the method was unreliable or flawed. What I was saying was that flaw lies in using an assumption about the age of the world to prove that the world is old. The method itself is fine. But one has to be careful with using the method to do what it was not supposed to do--prove that the world is old.


You argue the same way about evolution, with vague references to the assumptions it doesn't make. However, not long ago people were physically fighting over evolution. It had to fight a very uphill battle in order to be accempted in a primarily Christian scientific community. It's amusing that one would argue that science supports naturalism when so few scientists are naturalists.

Physically fighting over evolution? I didn't know that? When? Where?

I don't think science supports naturalism at all.

On the other hand, I have been allowing for natural processes accomplishing God's purposes. It see this all the time. In other words, I think God uses both natural processes and miraculous ones. The natural process would appear to be one that God does not interfer with, but it accomplishes his purposes anyway.

Or perhaps our powerful God knew when he set the whole thing in motion that laws the universe obeys will create the species called Man. Why would got have to interfere in a process he created in the first place and has omniscient knowledge to know the outcome. Suggesting God had to interfere to accomplish his purposes limits his role to a reactionary rather than one who knows the outcome of every action he takes from the beginning of time and beyond.



They are narrower, simply because they have one less option. But I don't dismiss the other side. I simply disagree with them.

How is that different? You do dismiss the other side. You've openly said so. You've stated that you will not explore the possiblity of some things being correct because you don't believe they are currently. Do I need to quote you, because that's a pain in the ass?

I have been saying that they *do* preclude God. They rule him out.
(I get the distinct feeling that you are misreading my posts when I have to repeat myself so often, SC. I'm sure you don't intend to do that, but it sure looks that way.)

No, they do not preclude God. A select few scientists argue that God does not exist or that science can or does prove this, but the majority of scientists are Christians who simply recognize the inability of science to address God in any way.

I, on the other hand, do not assume either a miracle or a natural force, but allow for both. They have one less option than me.

Amusing. They don't say miracles cannot happen, they simply look for an explanation. They can't look for a miracle because by definition it cannot be naturally explained. The only evidence for a miracle is a lack of a natural explanation. (Using miracle the way you use it. Some, like Dem, use it differently.) In order for you to be satisfied, they must stop seeking a natural explanation. I allow for a third option that you've openly called impossible. That God is actually a little more capable of planning than you give him credit for, so all that does occur and will occur was a part of his plan from the beginning. In my view, his interference would require Him to need to correct a wrong. I don't view God as having made the mistake in the first place. Does that mean I must reject the possiblity of God or simply reject your explanation of him?

Because my declaration is based on personal evidence, the sort that I cannot use to convince you or anyone else. In science, on the other hand, you have to be able to support every assertion and conclusion with public evidence and a reasonable argument. That's the difference between a personal conviction and science.

Yes, but you want personal convictions to become science because you think that would somehow make it better. Amusing if you were kidding. Not amusing, because you're not.

I suppose you could say that. I know my mother, and you don't. Therefore, since I insist that she exists (although I cannot prove it to you), you might think me narrow, and you might be right. But my 'narrowness' is based on my personal evidence of God, while the 'narrowness' of naturalism is based on an assumption.
You certainly could prove you have a mother. In addition to the fact that you could actually use various methods to prove her specific existence, there is the fact that all people have a mother and thus so would you. By mere extrapolation, we know your mother exists, whether or not we ever see her.

This is not true...

They have at LEAST as many options (most likely more... since I know for a fact you don't believe ALL religious answers to be equal)... they just don't construct their calculations around any assumption that cannot be verified...

Indeed. A scientist who includes no religious assumptions at all is much more broad that someone who includes one. After all, someone who assumes nothing about God has allowed for the existence of God, the nonexistence of God, the existence of multiple gods, the existence of reincarnation, etc., etc., etc.

Entrophy is a very strange duck. It is not always obvious which state is the one with the greater entrophy. Sometimes a more complex thing is in fact one with a higher state of entrophy. A helium atom seems more "complex" than two hydrogen atoms but is in fact a lower energy state. The process of turning the mostly hydrogen sun into a combination of helium, carbon and other heavier atoms results in a greater amount of entrophy. Over the time of the earth the energy which was stored by the gravitational formation of the planet is escaping. The days are getting longer. The language is getting less complex. And so on.

Bah, scientist this and scientist that. The notion that the universe might be completely knowable is the equivalent of a scientific heresy of the 19th century. Science is not about finding answers. Science is about finding more questions. The answer to each question leads to more questions. Science cannot fully explain anything because the potential questions of the universe is transinfinite.

Jocabia? Your back? I thought you were leaving NS? Didn't you start a thread about that?

As for your impressive research on that past discussion on radioactive dating, I did not find the words 'flawed' and 'unreliable' in my original post. I simply said that the method is based on an assumption, and that it is not wise to use an assumption to prove a point.

I read all 30+ pages of that thread. I also have an odd memory for such things. You're welcome to read it through if you like, or you could just trust me. You did call it unreliable and flawed. The amusing part is that the initial assumpton of exponential decay can be observed. It can be shown that all forms of dating that are currently used support radioactive dating. All of our ability to analyze things like bark rings in very old trees match up with radioactive dating. There truly is no evidence against radioactive dating. But in the flawed way, you approach all science you require things to be proved instead of requiring them to be disproven or supported as is the definition of the scientific discipline.

I think you are attacking a point that I never made. I never said that the method was unreliable or flawed. What I was saying was that flaw lies in using an assumption about the age of the world to prove that the world is old. The method itself is fine. But one has to be careful with using the method to do what it was not supposed to do--prove that the world is old.

Ha. Amusing. I guess I'll go back and show where you specifically said the method doesn't work. I'll post the quote in a bit. I am reacting to parts of that thread and things you directly said. It's important to remember the things you complain to know to be true, because the truth shouldn't be constantly changing as we educate you, unless you admit your original position was one of ignorance.

They didn't use it to prove the age of the earth. They used it to explore the age of things on earth. Some of it requires some extrapolation, but even if they were off by an order of magnitude the earth would millions upon millions of years old.

Physically fighting over evolution? I didn't know that? When? Where?

I don't think science supports naturalism at all.
Then why do you keep talking about naturalism. You've argued in several threads how mainstream science is naturalistic. I find this amusing since, given that the majority of mainstream scientists are religious, it's basically impossible under most rational definitions of naturalism.

And as far as the fighting, are you kidding? Evolution was violently received. You think it was dangerous to be the guy who allowed black people into a school, try being the guy everyone things is teaching your kids that God doesn't exist.

I got half way through the first link and decided that these arguments were indeed rather crappy. Couldn't you find something half decent, Straughn?
I doubt you got through any of it. It's not your "style".
Also - it was for Kyronea, not you specifically - but now that you've brought attention to it, i'd be impressed to see you utilize your vexed "logic" to deal with an issue so close to your "heart".
Go ahead and attempt to debunk them.
I seriously doubt your ability to do them on anything other than emotional grounds, seeing as how that's the base of just about every argument you have on this issue.
Go ahead and post some material from it, and show how your emotional reasoning overrides the issues raised. I note that you didn't. No surprise.

That is not what naturalism claims. It claims that everything happens only using natural forces. There is a difference. Science is not naturalist but it does only accept natural (read: evidenced) explanations.

Mmmm, I'm not sure that that is a significant difference. If you are only accepting naturalist explanations, that would make you a naturalist. On the other hand, if you allow that God had anything to do with the universe (even if it was only the start), then you are not a naturalist (or not a strict one) and in fact, a true naturalist would consider you a creationist of some sort.



Ah, there you go. "The naturalist does not." That's the point. You misstated when you described naturalism in the earlier paragraph. An explanation that does not include the supernatural for practical purposes does not exclude the possiblity of the supernatural.

That seems to be an irrelevant distinction. But I think I can understand where you are coming from. You want to retain your belief in God, and yet not have to assign an function to him in the material world. That would mean that your faith would not be challenged by anyone who could demonstrate that particular function as being explained by natural causes. But unless you think God had nothing to do with the universe, you cannot really hold such a position.

For example, perhaps you say that you recieve comfort from God. Would that be an interaction between God and the universe? Might not science be able to explain that comfort in a way that leaves God out of existence?


So you allow as one of the possible existences of the universe that God played no part in it whatsoever?

No, not completely, since my definition of God would have to be altered to a deity that does nothing. Rather, I know he does interact with the material world, but I cannot say how.


In other words, you don't allow for both. You allow for only the explanation that includes God in the workings of the world. In fact, you've argued that he must be able to interfere in the world or else he can't forgive our sins (a ridiculous conclusion, but you argued it nonetheless).


Did I? At any rate, He must be able to interact with the material world if we are to recieve comfort from him, since we are in the material world (as far as I know).



In order to be truly open-minded you have to accept the possiblity that God never has interfered in the world. You have openly stated that you don't accept this possibility and saying that no involvement can have occurred is just as close-minded as saying some involvement MUST have occurred.


How can I say that God may never have interferred with the material world when I know that I have recieved His comfort?


I find it amusing that in each thread you make more and more of an effort to pretend like your analysis in this subject is objective and simply looking for truth. All evidence supports that you start with truth in hand and deny all that you believe goes against your 'truth'. Why pretend otherwise?

I reckon that you are seeing me try to present my opinions in a way that is more objective, less likely to get people angry and emotion (which kills a good discussion). It seems to be either find a way to communicate without enraging or upsetting people, or don't bother.
I suppose some of my ideas have developed, and I suppose I have become more objective about the issue.
But I can tell you that I am not trying to pretend at all. And I do start with my personal evidence of God. Why should I start anywhere else? It is more to me than all the world.
If I sound objective, it would only be because I want to have a decent communication with people on the other side of the debate.

but in your analogy "uneducated guessing" is just that, uneducated

Um, yeah, that would be the point. That would be why I used the word. Asking people to base science on the unverifiable turns science into simply uneducated guessing. Can you actually say that someone claiming the universe was created by the sneeze of the great creator is making an educated guess? Keep in mind that an educated guess is not one based on personal beliefs, unless you're simply guessing what someone believes.

You have the wrong meaning of my use of the word 'meaning'.

Hahahahahahahaha!!!!!!
Hohohohohahahaha!!!
http://www.websmileys.com/sm/crazy/660.gif


Say, it is kinda fun to jump in on others' arguments, isn't it?

That seems to be an irrelevant distinction. But I think I can understand where you are coming from. You want to retain your belief in God, and yet not have to assign an function to him in the material world.

In SCIENCE, no functions are assigned to God in the natural world. That does not mean that a scientist cannot believe that God has interacted or does interact with the natural world. It simply means that a scientist who believes as such cannot use science to study that belief.

For example, perhaps you say that you recieve comfort from God. Would that be an interaction between God and the universe? Might not science be able to explain that comfort in a way that leaves God out of existence?

Of course. There are plenty of possible natural explanations for what we feel as comfort and guidance from God. And, from a purely scientific standpoint, they are all we have to explain these things. Those of us who are faithful, however, believe that these things come from an outside source. Thus, we believe we have information that science does not on the existence of the supernatural. We do not use science to try and examine the comfort or guidance we receive from God, because we know that we cannot.

No, not completely, since my definition of God would have to be altered to a deity that does nothing. Rather, I know he does interact with the material world, but I cannot say how.

So you don't ever question your faith? You believe yourself to be infallible on this point and thus will discount any other viewpoint as absolutely wrong?

How can I say that God may never have interferred with the material world when I know that I have recieved His comfort?

Do you know that? With 100% certainty? Are you claiming infallibility?

If you cannot admit the possibility that your beliefs are wrong, you have no faith to speak of. Faith must be questioned to be truly held - and the faithful must recognize our own fallibility.

Mmmm, I'm not sure that that is a significant difference. If you are only accepting naturalist explanations, that would make you a naturalist. On the other hand, if you allow that God had anything to do with the universe (even if it was only the start), then you are not a naturalist (or not a strict one) and in fact, a true naturalist would consider you a creationist of some sort.


False Dichotomy.

Only accept natural explanation = Naturalist...?

Allow that god was involved = Creationist and/or NOT-Naturalist...?

What about people like me... who neither 'allow' nor 'disallow' God to be involved in the process...? It doesn't MATTER if god was the initiator, if all you are looking at is the MECHANISM.

What about people like me... who neither 'allow' nor 'disallow' God to be involved in the process...? It doesn't MATTER if god was the initiator, if all you are looking at is the MECHANISM.
Quite apparently the difference between a semanticist (Bruarong)
and a pragmatist (yourself). *bows*

Sure it can. When I shuffle a deck of cards - I am doing something randomly. However, I specifically recognize and act upon the patterns that I am randomly dealt.

I don't like that analogy. It isn't like what we are dealing with. In abiogenesis, there isn't an intelligent life than can recognise intelligent information (like you are recognising the shuffled cards).


You are trying to do things backwards, assuming that the method of recognizing the pattern has to exist before the pattern does. In truth, one cannot use a pattern for information until that pattern has been formed. Only then can a "use" be found for it.

I'm doing it backwards?? Maybe we do have to work backwards here in order to picture it best. At any rate, that makes more sense then 'finding' a use, since inanimate ojects are acted upon, rather than finding uses for patterns.



If I developed a computer that ran a program based on patterns on a beach, would the patterns suddenly become information? Or were they always simply patterns, and now I am using them as information?


It would depend on how you designed the computer program. You might discover something about the nature of waves and sand. I doubt you would find anything that would help code for a lipid synthase. At any rate, you have supplied a program, and that makes you a designer. Still not a good analogy, Dem.


Irrelevant. You see something exactly like that in polymer chemistry. You can't take one specific form of order and expect all spontaneously arising order to look exactly like it.


No, quite to opposite. Life would not form very well if the only sequences form from polymerisation all coded for a DNA ligase. But since sequence is more likely to be determined by available building blocks at the polymerisation site (rather than any other factor), the complexity is not going to be information.


Of course it does. It may not be information that would do anything that we would recognize, but it is information just as surely as information in an actual gene is.


Rubbish. It isn't information unless it means something. Unless the sequence serves a purpose, it is meaningless.


Once life is established, this is true. Hence the need for controls - and the use of DNA, rather than RNA for coding the genome.


By controls, I suppose you mean someting the prevents spontaneous polymerisation. But wouldn't that something be more likely to prevent the rise of information? Would it really be a help or a hindrance to abiogenesis theory?


No, it was most likley RNA, at least at first.



If you have ever worked with RNA, you will know how infuriatingly unstable the jolly thing is, on account of all the RNases. Now, RNAses are lethal to a cell, unless there is a jolly good protection system in place. So we need to development of the protection system before we have RNAses, which means that natural selection is perfecting the protection system without the RNAses.


You keep saying this. I'd like to see you back it up.


Information is not information unless it means something to someone. A nonsense sequence is itself a message that means 'nonsense'. Other than that, it must be recognised as having a message before it can be considered information.

I suppose I cannot really demonstrate that randomness cannot create information, but since I have never seen it happen, I remain skeptical.


We aren't talking about the here and now, my dear. We are talking about something that may have occurred before complex lifeforms. In complex lifeforms, it would be a problem, just as too much mutation becomes a problem. But as a possibility for the origin of life, self-polymerization would be much more likely to lead to "information".


I disagree. I think that any primitive DNA replicase or RNA polymerase would be a great disadvantage to the cell if it were to catalise energetically expensive operations which would only result in useless RNAs or proteins--or even worse, accumulation to the point of being detrimental. We see this in modern life. Overexpression of cloned genes is usually a disadvantage, unless it contributes to e.g. antibiotic resistance.


Any sequence has a message that can be read, even if it is nothing more than a series of stop and start codons. Information is not inherent in the code - it is derived by the use of the code.


Quite right. Which means that just having a sequence is not enough. It needs to be specified, because in order for life to survive, there are some basic conditions that need to be met, e.g., a compartment or cell wall that allows the generation of energy, or an electo-potential.


Of course it doesn't. But you are trying to claim that it predicts that evolution would not have occurred. By claiming that, you are either claiming that evolution is wrong or that the SLT2 is wrong. If a theory's predictions are incorrect, it is an incorrect theory.


No I'm not. I'm saying that it doesn't predict anything about evolution. It is humans that understand the law that make the predictions. The law predicts nothing other than what the description says.

My feeling is that if this issue wasn't so important to the God exists/God doesn't exist debate, people would not hesitate to discard to idea of abiogenesis as mere fantasy, science fiction, a modern myth.


And herein you say the exact same thing you've been saying - and it is no less wrong. SLT2 does not in any way suggest that there will not be focusing of energy - and we see such focusing throughout the natural world all the time. To suggest that the one type of "focusing" you don't personally like contradicts the predictions of SLT2 is to demonstrate your own extreme bias.


SLT does indeed predict that matter will take the most stable energy form, but it isn't the only law operating in the universe. Where we see deviations from SLT, we can explain it in terms of other laws of nature. Life itself works against SLT, since it keeps our bodies at a fixed temperature (whereas SLT would mean that our bodies are the same temperature as our environment).




You can believe that all you like, but there is nothing in the SLT2 or in the empirical evidence to suggest it.

Next you will be saying that abiogenesis is even likely. Or?

You can't prove or disprove the existence of God using physics. If there is a God, he obviously exists on a higher plane of thought than our minds can understand.

I'm sick of all this pooflinging at Intelligent Design. It's a dumb idea, yes, and it shouldn't be taught in schools, but that doesn't mean everybody who does believe is a total idiot. Back in the day a bunch of smart people were Christians.

I can't tell what you guys are talking about anymore, but you were talking about this at one time.

Science has always asked how. Religion has always asked why. The two main theories of creationism are not conflicting. I belive that God created the world. I beleive that He did it through the process of evolution. Others may beleive that evolution just happened. But, what I don't know is how creationsists think God created the Earth. Do they think everything just poofed there, or got zapped down by lightning? In the movie which the name escapes me, it tells the story of Darwin, and the court problems he went through. At the end of the story, when the verdict is given, one lawyer died of heart complications, and the other experiencing shifting of his paradigm, he satrts to pack up to leave. Alone in the court room, he comes across the bible, and the science book. He stares at them both for a moment, then proceeds through the door with them both in his arms. The point given that religion and science are both important, and they exist in harmony. I beleive in both creationism, and evolution.

Mmmm, I'm not sure that that is a significant difference. If you are only accepting naturalist explanations, that would make you a naturalist. On the other hand, if you allow that God had anything to do with the universe (even if it was only the start), then you are not a naturalist (or not a strict one) and in fact, a true naturalist would consider you a creationist of some sort.

But science and the vast majority of scientists would not. Most scientists believe in God and much of them are still looking for only natural explanations in their science. That is because they believe that only natural explanations can be evidence emperically not because no other involvement is possible. The vast majority of scientists accept the possiblity of God/gods and that God had some hand in the state of the universe today.

That seems to be an irrelevant distinction. But I think I can understand where you are coming from. You want to retain your belief in God, and yet not have to assign an function to him in the material world. That would mean that your faith would not be challenged by anyone who could demonstrate that particular function as being explained by natural causes. But unless you think God had nothing to do with the universe, you cannot really hold such a position.

I don't assign anything to God. God IS. I simply do my best to describe him. Science has no place in doing so.

And again you limit God to your belief. What if God's interference in the universe is through natural forces. What if those forces are exactly as God planned them and the outcome is exactly as He planned? Again, you limit God to the role of reactionary and then say that people who don't are narrow-minded.

For example, perhaps you say that you recieve comfort from God. Would that be an interaction between God and the universe? Might not science be able to explain that comfort in a way that leaves God out of existence?

No, it would not be an interaction in the emperical sense. That comfort could just as easily come from the idea of God as from God, Himself. God created the world and us in such a way that we might find comfort in Him even without direct knowledge. That is why we use faith in religion and emperical evidence in science and why they are distinct from one another.

No, not completely, since my definition of God would have to be altered to a deity that does nothing. Rather, I know he does interact with the material world, but I cannot say how.

Not does nothing. Simply God is not restricted by time. Thus anything he did affects today in exactly the way God intended. Constant control is something people with no foresight have to do. An omniscient being has no need for tweaking the system.

And by saying you know he does interact with the material world, you claim a position that is narrow-minded, moreso than one who does not address it at all. It's amusing that you cannot see how this is true.

Did I? At any rate, He must be able to interact with the material world if we are to recieve comfort from him, since we are in the material world (as far as I know).

Why? If God didn't exist and you were simply receiving comfort from your belief in Him would it be any different. Again, our reaction to God was predetermined when God set the whole thing in motion. He doesn't have to correct his design flaw by supporting us directly.

How can I say that God may never have interferred with the material world when I know that I have recieved His comfort?

You don't know that, in fact. You know you have felt comfort and you know that you attribute it to him. That may very well be a result of the design of everything leading up to that comfort that made it so that you would feel comforted. It has a natural explanation (you being comforted by the idea) and a miraculous one. It is your limitation of God that makes you think that a natural explanation must preclude God from the equation if it doesn't mention Him.

Meanwhile, I know of no scientist that claims that you cannot be comforted by God.

I reckon that you are seeing me try to present my opinions in a way that is more objective, less likely to get people angry and emotion (which kills a good discussion). It seems to be either find a way to communicate without enraging or upsetting people, or don't bother.
I suppose some of my ideas have developed, and I suppose I have become more objective about the issue.
But I can tell you that I am not trying to pretend at all. And I do start with my personal evidence of God. Why should I start anywhere else? It is more to me than all the world.
If I sound objective, it would only be because I want to have a decent communication with people on the other side of the debate.
Here's the point. You're not openly analyzing the evidence and it is evident in much of what I've read of your posts (and it's a lot of them). It's great that you believe in God. I'd convert GnI if I could. However, you limit your definition of him and it makes you reject emperical evidence. God is not so limited. If God created all that is, why couldn't a natural explanation be just as much a miraculous one as God acting at the very moment to make something happen?

I'm trying to varying degrees of success to react to what you say now and not where you were when I first encountered you, but you must keep in mind that much of what I've learned of you disagrees with the open view you claim to have.

You can't prove or disprove the existence of God using physics. If there is a God, he obviously exists on a higher plane of thought than our minds can understand.

I'm sick of all this pooflinging at Intelligent Design. It's a dumb idea, yes, and it shouldn't be taught in schools, but that doesn't mean everybody who does believe is a total idiot. Back in the day a bunch of smart people were Christians.
Perhaps Aquinas ...

A man should remind himself that an object of faith is not scientifically demonstrable, lest presuming to demonstrate what is of faith, he should produce inconclusive reasons and offer occasion for unbelievers to scoff at a faith based on such ground.

What makes you think it is either miracle or evolution?
Can evolution itself not be seen as a miracle if caused by God?

Yes, but by 'miracle' I mean a suspension of the laws of nature. But, sure, I know what you mean. Either way (evolution or creation), God was responsible for placing humans on earth, according to our faith.


Is it not possible that some other mechanism, as yet undiscovered, caused our species to arise on Earth?

That is a possibility that I sometimes consider. But what sort of mechanism would you be thinking of?



"Naturalism" as you define it, has nothing whatsoever to do with science. The vast majority of scientists are religious people who believe in a Creator. They just recognize what you often fail to - that the methods of science are only valid within nature. Nothing about any scientific theory precludes the involvement of God. It simply cannot and will not assume it.

So you think I fail to see that the methods of science are limited to nature? I don't think you have understood my position very much. Which is fine. You don't have to. But what both debating with me if you aren't going to at least try to understand me, sister? I don't think my position is really that hard to understand.

And incidentally, I have always said that science does not rule out God. Just goes to show that you are just saying your little piece irrespective of what I have been saying.



Once again, this has nothing to do with science. Most scientists are not naturalists, by this definition. However, scientists do recognize that they can only use science to study that which can be explained by natural forces. Outside of that, another method (such as theology, other forms of philosophy, etc.) must be used.


I'm not sure about your assertion of 'most', since it is possible to believe in God and still be a naturalist. My position is different, since while I fully believe in a God that is capable of working miracles through both the supernatural and the natural forces, in my job, I pursue only natural explanations.
Otherwise, that statement sounds a lot like something I would say. Which makes me wonder if you have yet to understand my position, since you felt the need to say it.


If a scientist uses the supernatural in a scientific explanation, they are not scientists. If a scientist believes that the supernatural exists, and is is involved in a process in some way, then said scientist believes he cannot study that process with science, and must look at it with another field of study.

Hmmm, that's an interesting idea. But what is the difference between a 'scientific' explanation, and any other explanation?
At any rate, my tendency to criticize evolution does not necessarily come about because I think it naturalistic, but because I feel that it does not mechanistically work in many places. I have already said that God is capable of using both evolution and creation, so that is obviously not an issue for my faith.


You have argued against speciation quite a bit - not to mention that those who split evolutionary theory into "microevolution" and "macroevolution" use speciation as the point for "macroevolution". Thus, if you acknowledge that speciation occurs through natural selection, you have accepted "macroevolution".

I don't consider speciation as macroevolution. And I do allow that macroevolution may have occurred, though I am skeptical of some parts of it.


Does it bother you that no one has yet included God in theories on black holes or quantum mechanics (you want to talk about some weird stuff with no clear explanation)? Scientific theories cannot inject God, as God is an untestable and unfalsifiable assumption. So, yes, you will see an absence of God in evolutionary theory, just as you see an absence of God in thermodynamics, physics, chemistry, etc. That does not, however, suggest that there are only natural forces. It simply means that we only use science to study natural forces.

I've no problem with people who write scientific papers and that don't include God in them. I do the same. I do have a problem with people who try to argue that science shows that the Bible is wrong, or that God does not exist, since I believe that it does neither.



It is the very method of science that does not allow for God to be used in a scientific explanation. Unless, that is, you have a way to falsify God?

Dem, we have been through all this before. I agree with your first statement. And the answer to your question is 'no'.


You should talk to John Doyle at CalTech. Interesting guy. Mathmetician. Has quite a bit to say about the various forms of complexity that arise out of chaos.

John Doyle......Googling....dynamic feedback systems and steady state analysis.....I didn't find much about complexity arising out of chaos....where did you find that?

So you think I fail to see that the methods of science are limited to nature? I don't think you have understood my position very much. Which is fine. You don't have to. But what both debating with me if you aren't going to at least try to understand me, sister? I don't think my position is really that hard to understand.

And incidentally, I have always said that science does not rule out God. Just goes to show that you are just saying your little piece irrespective of what I have been saying.

I notice you say this a lot and to a lot of people. That's because while you claim to believe this you waffle back and forth between suggesting the majority of scientists are naturalists to blaming it on the methods of science. If you're not talking about science as a discipline being naturalist and all evidence suggests the vast majority of scientists are religious, why do you keep bringing up naturalism and equating it with modern science? Your actions speak louder than words and your actions suggest that you equate naturalism and the scientific method.

...because I feel that it does not mechanistically work in many places...

Some of these places being what exactly?

Some of these places being what exactly?
The problem here is that no matter what Bruarong claims, the respect for the scientific method isn't there. If there were big gaping holes as Bruarong claims he could make himself famous by exposing those holes, but, as of yet, no one has. If the theory isn't disproven under the immense scrutiny it receives it stands to reason that it's because it is the best theory available. I find it no coincidence that all of the accepted scientific theories he questions are ones that seem in conflict with common scriptural beliefs.

Even in this thread said that radioactive-dating is 'based on unverified assumption" and yet it stands up to every test we perform on it. The calibration becomes more and more precise, but since accepting that it is a valid scientific theory requires excepting an old earth, he softly rejects (while more or less claiming not to actually reject it). There is nothing scientific about his approach to the matter. His claims require not just the calibration of radioactive dating to be wrong but for the entire process to be so wrong that we are off on the age of the earth by several orders of magnitude. SEVERAL.

That's the problem. Seemingly, suddenly science is held to a higher standard whenever it's something he wants to be wrong. How convenient.

The problem here is that no matter what Bruarong claims, the respect for the scientific method isn't there. If there were big gaping holes as Bruarong claims he could make himself famous by exposing those holes, but, as of yet, no one has. If the theory isn't disproven under the immense scrutiny it receives it stands to reason that it's because it is the best theory available. I find it no coincidence that all of the accepted scientific theories he questions are ones that seem in conflict with common scriptural beliefs.

Even in this thread said that radioactive-dating is 'based on unverified assumption" and yet it stands up to every test we perform on it. The calibration becomes more and more precise, but since accepting that it is a valid scientific theory requires excepting an old earth, he softly rejects (while more or less claiming not to actually reject it). There is nothing scientific about his approach to the matter. His claims require not just the calibration of radioactive dating to be wrong but for the entire process to be so wrong that we are off on the age of the earth by several orders of magnitude. SEVERAL.

That's the problem. Seemingly, suddenly science is held to a higher standard whenever it's something he wants to be wrong. How convenient.
Admittedly, s/he's pretty good at generating a buzz about his/her opinion.
Kind of like a Corneliu-in-the-wings.

But science and the vast majority of scientists would not. Most scientists believe in God and much of them are still looking for only natural explanations in their science. That is because they believe that only natural explanations can be evidence emperically not because no other involvement is possible. The vast majority of scientists accept the possiblity of God/gods and that God had some hand in the state of the universe today.


I also only look for natural explanations while at work. I only learned the sort of science than can look for natural explanations. That doesn't make me a naturalist either.

But let me get this straight. Do you, or don't you believe that God had anything to do with the universe? That's always been a question in my mind as I read your posts.


I don't assign anything to God. God IS. I simply do my best to describe him. Science has no place in doing so.


But a description of God should include something about what he does, should it not? So, what does God do, Jocabia?


And again you limit God to your belief. What if God's interference in the universe is through natural forces. What if those forces are exactly as God planned them and the outcome is exactly as He planned? Again, you limit God to the role of reactionary and then say that people who don't are narrow-minded.


Firstly, I have not limited God, because I have allowed that he may have used creation or evolution. Either way, his purposes were fulfilled, and I have not limited him. Rather, when someone limits God to natural forces only, that would have to be more narrow than my view point. Simple mathetics. One is more narrow than two.

Secondly, if I say that God is good, and only good, then I have 'limited' him, have I not? And wouldn't he want me to 'limit' him in that way?

Thirdly, what do you mean by saying that I have limited God to the role of reactionary? Do you think I am limiting God to using miraculous forces only?


No, it would not be an interaction in the emperical sense. That comfort could just as easily come from the idea of God as from God, Himself. God created the world and us in such a way that we might find comfort in Him even without direct knowledge. That is why we use faith in religion and emperical evidence in science and why they are distinct from one another.


Thus, if someone genuinely believed in the tooth fairy or Santa Klaus, then the comfort that they recieved from them would not actually be from these non-existent characters, but from somewhere inside the head of the believer. In such a scenario, the comfort would not come from God, but from belief itself, regardless of whether that belief was true or not.

And regardless of whether someone believed in God or not, they recieve the comfort from Him? Is that what you are saying?


Not does nothing. Simply God is not restricted by time. Thus anything he did affects today in exactly the way God intended. Constant control is something people with no foresight have to do. An omniscient being has no need for tweaking the system.


I don't see how being free of time restrictions solves your problem. Either God does or he does not interact with the natual world. Either he did send Jesus to save us, or he did not. Either he did start the whole process (including time), or he did not.
I gather that you think God started it all, and now sits back watching his handiwork, no longer tweaking the system. So that would make you a creationist, since you think God created that who shebang. Why, then, are you debating me? What is your actual disagreement with me?


And by saying you know he does interact with the material world, you claim a position that is narrow-minded, moreso than one who does not address it at all. It's amusing that you cannot see how this is true.


Perhaps it is more 'narrow' than the one who does not address it, but not more narrow than the one who rules out his interaction. But I did say that I could not honestly question his interaction with the world. I might question your mother's love for you, and you might insist that she does indeed love you, but would that give me the right to call you 'narrow' regarding your opinion of your mother? That sort of narrowness is based on knowledge, and it not therefore narrow, but a conclusion based on knowledge, on personal experience.


Why? If God didn't exist and you were simply receiving comfort from your belief in Him would it be any different. Again, our reaction to God was predetermined when God set the whole thing in motion. He doesn't have to correct his design flaw by supporting us directly.


Either I am recieving comfort from my belief (and my belief in God is mistaken) or I am indeed recieving comfort from God. I see only two possibilities in this case. And if God did not exist, then a belief in pink bunnies would serve the same purpose, so long as it was a genuine belief.

But are you restricting God to a position of setting the universe in motion and then having no more interaction with it? Wouldn't that be a type of limitation?


You don't know that, in fact. You know you have felt comfort and you know that you attribute it to him. That may very well be a result of the design of everything leading up to that comfort that made it so that you would feel comforted. It has a natural explanation (you being comforted by the idea) and a miraculous one. It is your limitation of God that makes you think that a natural explanation must preclude God from the equation if it doesn't mention Him.


The natural explanation would be that the act of believing is where the comfort comes from, not from God. Fortuantely, my experience of God is a good deal more than mere comfort, although I appreciate that as well. God makes a great comforter in times of trouble, but he does a lot more than that.
But you are right, in a sense, that I cannot know that it was God. On the other hand, you and I cannot know that our parents are our parents. We cannot even know that we really exist. We cannot know that we are not simply ideas in someone's imagination, or characters in some old chap writing a story. In fact, there is a great deal that we cannot know. But I would say that I know God loves me, and that I know this more than just about anything else I know.



Meanwhile, I know of no scientist that claims that you cannot be comforted by God.


perhaps the ones that believe that God doesn't exist might say such a thing.


Here's the point. You're not openly analyzing the evidence and it is evident in much of what I've read of your posts (and it's a lot of them). It's great that you believe in God. I'd convert GnI if I could. However, you limit your definition of him and it makes you reject emperical evidence. God is not so limited.

Then tell me how I could be more open. I have got an opinion about God, and perhaps that does mean a limitation of him. But you also have an opinion about God, and so does the chap who thinks God doesn't exist. Every opinion about God limits him, so I don't think you are being fair to criticise me for having an opinion of God. Besides, having an opinion about God should not affect one's science, which is what this debate is all about. And people are perfectly entitled to think whatever they like about God. If I chose to do me science with the personal belief that God is capable of working miracles, why should that concern anyone? It won't bother my boss, because she is only interested in progress in research, and I can do that fine without any compromise in my beliefs.

And if you can show me where I have rejected empiricle evidence because of my opinion of God, I will thank you. But I don't think you can, because I don't think I have.


If God created all that is, why couldn't a natural explanation be just as much a miraculous one as God acting at the very moment to make something happen?

Indeed. I agree. Perhaps it would be even more miraculous. But it isn't necessary to hold to that position, and I suggest that if you are, you are limiting God quite a bit.


I'm trying to varying degrees of success to react to what you say now and not where you were when I first encountered you, but you must keep in mind that much of what I've learned of you disagrees with the open view you claim to have.

I appreciate your efforts. And I must say that you seem to have improved your manners, since when I first encountered you, I can remember wondering whether you really did take Jesus' words seriously about loving your neighbour, not to mention your enemy.

Some of these places being what exactly?

Interesting that you ask. For example, something I was thinking about the other day was natural selection explaining bee hives. In a bee hive, there is one reproductive insect, the queen, while all the others are drones. No doubt the fact that they are drones does help survival. But natural selection works at the level of the individual. Anything that is truly unselfish, that does not benefit the individual in some way, does not really fit in with natural selection being a major cause in the development.

Now, I know very little about the insect world, and I probably should have done some research before posting my thoughts for all to see on NS. But I wonder how an evolutionist would explain this phenomenom.

Actually, if I turn to my own area of experience, such as bacterial genetics, I can think of several situations where evolutionary theory is either lacking or weak to explain the phenomenom, such as shrinking genomes (and no evidence of expanding ones).


But rather than turn this post into another long one, I'm going to bed.
If I feel up to it, I might have a go at this tomorrow, since I have a day off work. Not sure that I want to spend it on NS though. Maybe.

Interesting that you ask. For example, something I was thinking about the other day was natural selection explaining bee hives. In a bee hive, there is one reproductive insect, the queen, while all the others are drones. No doubt the fact that they are drones does help survival. But natural selection works at the level of the individual. Anything that is truly unselfish, that does not benefit the individual in some way, does not really fit in with natural selection being a major cause in the development.

Now, I know very little about the insect world, and I probably should have done some research before posting my thoughts for all to see on NS. But I wonder how an evolutionist would explain this phenomenom.

IMO, it doesn't have to benefit the individual, just their genes...but wait, how exactly are they not individually benefitting from being drones?

Actually, if I turn to my own area of experience, such as bacterial genetics, I can think of several situations where evolutionary theory is either lacking or weak to explain the phenomenom, such as shrinking genomes (and no evidence of expanding ones).

Oy...I dunno much genetics...Have you ever been able to tell what's leaving? maybe it's just some nonsense...I would really know, all I get is the basics of intron and such in school.

Expanding genomes happen all the time. Almost all modern crops are polyploid varients of some precursor species. Granted, that particular form of chromosomal variation doesn't happen too often in animals, but there are other ways. That just happens to be the most obvious and the easiest to understand of the examples.

I also only look for natural explanations while at work. I only learned the sort of science than can look for natural explanations. That doesn't make me a naturalist either.

The sort of science? What sort of science looks for supernatural explanations?

But let me get this straight. Do you, or don't you believe that God had anything to do with the universe? That's always been a question in my mind as I read your posts.

Yes, absolutely. I've said so explicitly. I believe that God interacts with the universe through the laws he created.

But a description of God should include something about what he does, should it not? So, what does God do, Jocabia?

I don't actually know that, nor do you. I can guess, but I don't ascribe anything to God. God either did or didn't.

Firstly, I have not limited God, because I have allowed that he may have used creation or evolution. Either way, his purposes were fulfilled, and I have not limited him. Rather, when someone limits God to natural forces only, that would have to be more narrow than my view point. Simple mathetics. One is more narrow than two.

You have limited him. You have said that if one claims his interaction was as I describe then one must be denying him the ability to interact with the universe. Shall I quote you? You keep saying one is more narrow than two, but you don't recognize how you are narrowing the ideas you are calling the 'two' and ascribing an artificial narrowing when describing the 'one'. You also keep claiming no limitation, but whenever anyone suggests particularly things you claim it can't be so.

You amuse me. And I don't mean that as a compliment. You keep trying to make this claim of being open-minded while saying that God must have done something a particular way in order for it to qualify as involvement. Again, do I need to quote you or can you follow your own argument? You have limited God. Do I believe that God can involve himself in the daily lives of people? Yes. Do I think he MUST do so through immediate involvement rather than through a long slow process he knew would result in our comfort? No. Only you require that limitation. You accept the involvement of One God in One way and you openly admit to doing so. We see you be close-minded and you have openly admitted that you would not look for certain types of explanations if they don't match up with what you believe, because you've decided they do not exist. You've claim ridiculous kinds of proof are necessary (like a time machine) to avoid admitting that you simply aren't willing to accept the possiblity of certain outcomes. Keep claiming you're open-minded. It won't mean you ARE open-minded, but, hey, perhaps no one will notice.

Secondly, if I say that God is good, and only good, then I have 'limited' him, have I not? And wouldn't he want me to 'limit' him in that way?

No. Good is an opinion. And, no, I don't suspect that God would want you to limit him in that way. God is everything. Good is a human restraint. God just IS. If we describe everything associated with God as good and the absense of God as bad, then that's just a line we've drawn in the sand. It has nothing to do with what God is. I don't believe God is good. I believe good is God.

Thirdly, what do you mean by saying that I have limited God to the role of reactionary? Do you think I am limiting God to using miraculous forces only?

It means you've painted him with that requirement. Making him sometimes react rather preempt makes him a reactionary. According to you the only way he could have made you feel comfort is immediate involvement. According to you it requires a supernatural involvement, while most of us admit that if God started the universe in motion with the plan that natural forces would make you feel that comfort, no supernatural explanation required while God did it. No limitation. However, you require God to have supernaturally MADE you feel good and claim that a natural explanation is insufficient. If God made natural forces have that effect on you, then the natural explanation must by default be there. By denying it, you limit God to a different role, a role of reactionary, rather than planner.

Thus, if someone genuinely believed in the tooth fairy or Santa Klaus, then the comfort that they recieved from them would not actually be from these non-existent characters, but from somewhere inside the head of the believer. In such a scenario, the comfort would not come from God, but from belief itself, regardless of whether that belief was true or not.

No, the comfort they got from them would be from the belief. If that belief is a result of how we were designed by God, then the belief would also be from God. Just because you get meat from animals, does that mean God doesn't feed you?

And regardless of whether someone believed in God or not, they recieve the comfort from Him? Is that what you are saying?

We get everything from God if God created the universe. Everything. That he would have to actively involve himself in your piddly existence because he didn't already know your needs before your existence was even on the horizon is absurd.

I don't see how being free of time restrictions solves your problem. Either God does or he does not interact with the natual world. Either he did send Jesus to save us, or he did not. Either he did start the whole process (including time), or he did not.

Clearly, you're struggling here. Let's say the universe is a closed system. Let's say we can analyze it as far back as it's ultimate arrival on the scene, time and all. Let's say we eventually know everything about it and it's nature. Still doesn't eliminate God. Because God is outside nature and the universe and created it and all it's laws. He is also is outside time, so he didn't do it before the universe or after the universe or during the universe, but he simply did it. Becuase he has not limitation of time he knows the outcome of everything he does as he does it. There is no need for tweaking.

Everything will have natural laws explaining them because God made it that way and, yet, everything is still a product of God. God will still never be a part of the scientific explanation of the universe nor excluded from it, in that scenario, yet will be responsible for every bit of the happenings within.

I gather that you think God started it all, and now sits back watching his handiwork, no longer tweaking the system. So that would make you a creationist, since you think God created that who shebang. Why, then, are you debating me? What is your actual disagreement with me?

Creationism in common usage is in conflict with current science. I don't believe that. I believe everything in the universe can be naturally explained. And I believe that God does not have to tweak the universe. If you agree with me, you are perhaps the worst communicator I've ever encountered.

Seriously, I've seen very few people who weren't simply trolling who dance around the ideas as much as you do and make as many claims about open to certain concepts while simultaneously rejecting them on little more than "I don't understand them so I don't like them." You dismiss radioactive dating while admitting you don't understand it and referring in all sorts of eroneous ways. You dismiss evolution while arguing about abiogenesis (even though it's a seperate theory) and referring to man as having evolved from apes. You claim to be open-minded and then say that unless you accept a certain way of viewing God (and only your way of viewing God) then people must be refusing to allow for certain ideas.

It's become more than ridiculous. If you'd like to continue to debate. Start here. Clearly and openly express your views. Then *gasp* actually behave like you believe them. And before you make claims about a certain scientific view, actually understand what it says. Saying that you're a scientist and then saying evolutions says we evolved from apes is just embarrassing.

Perhaps it is more 'narrow' than the one who does not address it, but not more narrow than the one who rules out his interaction. But I did say that I could not honestly question his interaction with the world. I might question your mother's love for you, and you might insist that she does indeed love you, but would that give me the right to call you 'narrow' regarding your opinion of your mother?

Amusing. You started with the narrow-minded stuff. Now, you argue that it's not narrow-minded. Here's the point. You think things work a certain way in regards to God and you say scientists who don't are narrow-minded. The fact is the scientist who simply accepts that he cannot explore such a thing with science is the only one accepting all possiblities on that front. YOU are not. It's that simple. Stop trying to twist and turn and simply admit that your discomfort with science is that the currently and roundly accepted theories don't support your personal views and you wish they did.

That sort of narrowness is based on knowledge, and it not therefore narrow, but a conclusion based on knowledge, on personal experience.

You're just being silly. Really, really silly. You're narrow-mindedness is based on what you believe. You believe it's true of course and that plays into your personal experience but the fact that you treat it as if it's true is narrow when the fact is there are other possibllities and you are not addressing them.

Either I am recieving comfort from my belief (and my belief in God is mistaken) or I am indeed recieving comfort from God. I see only two possibilities in this case. And if God did not exist, then a belief in pink bunnies would serve the same purpose, so long as it was a genuine belief.

If God did exist a belief in pink bunnies would still serve the same purpose. However, if God does exist the comfort is from the idea (a natural explanation) and from God (a supernatural explanation. The existence of God does not change the natural role of the idea.

But are you restricting God to a position of setting the universe in motion and then having no more interaction with it? Wouldn't that be a type of limitation?

No, I'm not. His interaction is outside of time. His interaction is forever. It's always. Every moment. It's all directed by his design. Meanwhile, the explanations are perfectly natural. That's the way it was designed. It makes faith a requirement. I'm not restricting God. I simply recognize that either way, there would be no evidence of his involvement, so anything I believe is no more than a guess. I simply don't operate off the assumption that a natural explanation for everything in the universe is not available. Doing so would limit God. Does it mean I will have that explanation? No. It doesn't mean I shouldn't look for it.

You, on the other hand, have said that he MUST have interacted with the universe since its origin and you actually think we should treat theories in science as if they are looking for something that doesn't exist because some things were God's hand. You try to hide that belief in weak language, but you've admitted it before. You believe science by not expecting certain things to be the work of God and ignoring them is seeking to replace the work of God as an explanation with a wrong explanation. Your recent claims otherwise, don't actually evidence any actual change in your methodology. You play semantic games to pretend to be open-minded. "I didn't radioactive dating flawed. I only pointed out the flaw in it (without saying that so I can claim I didn't say it)."

The natural explanation would be that the act of believing is where the comfort comes from, not from God. Fortuantely, my experience of God is a good deal more than mere comfort, although I appreciate that as well. God makes a great comforter in times of trouble, but he does a lot more than that.

Still doesn't mean that there is no natural explanation. Is God so limited in your eyes that he can't make you experience all the things you experience through perfectly natural means? It's amusing that you keep saying that my beliefs are possible and then claiming that something has to either be from natural means or from God as if they are in conflict. This is the same point Dem is replying to. Either you believe natural explanations cannot also be Godly explanations or you are really bad at expressing the concepts you're trying to espouse.

But you are right, in a sense, that I cannot know that it was God. On the other hand, you and I cannot know that our parents are our parents. We cannot even know that we really exist. We cannot know that we are not simply ideas in someone's imagination, or characters in some old chap writing a story. In fact, there is a great deal that we cannot know. But I would say that I know God loves me, and that I know this more than just about anything else I know.

Amusing. You try to equate a bunch of existential philosophies with your defense of your position. Amusing. It doesn't make those things any more direct than you've already claimed. It doesn't make your evidence any more emperical. It simply shows that you're struggling to defend your denial of basic scientific principles so you're trying to turn the whole argument on its ear. The point is that there are natural explanations for your 'supernatural' evidence. It doesn't mean that when one accepts those natural explanations they must reject God or reject the entirety of reality. In fact, it's accepting that it is God's hand that is more along the lines of your examples here, because it requires nothing more than a belief.

perhaps the ones that believe that God doesn't exist might say such a thing.

You are so obvious when you're trying to avoid the point. You keep treating science as this naturalist mass. You claim you don't, but you bring it up in every thread. And then you use fringe examples as if they represent the general populous of science or scientists. It's just silly. Science looks at what is within it's realm of study. It's not a denial of God or the supernatural. It's a limitation of our ability to explore the world using evidence. You claim that naturalism is damaging pure science, but you have not shown in any way at all how that is occurring and every time we press you on it, you say something weird like this to pretend like we're talking about something else. I'm a patient man, but this is too much.

Then tell me how I could be more open. I have got an opinion about God, and perhaps that does mean a limitation of him. But you also have an opinion about God, and so does the chap who thinks God doesn't exist.

Frustrating. We're talking about science. You put your beliefs about God into your science (although whenever we press you, you claim not to). That's narrow-minded. Having beliefs isn't narrow-minded. Suggesting that everyone else who doesn't hold your beliefs and who doesn't approach things in the way someone of your beliefs would IS. You said at the outset that scientists who don't consider supernatural explanations in their activities are narrow-minded. Now you've managed to spin that into making out like we called you narrow-minded. We did eventually, but it was because you were suggesting that everyone who doesn't think like you is wrong.

Every opinion about God limits him, so I don't think you are being fair to criticise me for having an opinion of God. Besides, having an opinion about God should not affect one's science, which is what this debate is all about. And people are perfectly entitled to think whatever they like about God. If I chose to do me science with the personal belief that God is capable of working miracles, why should that concern anyone? It won't bother my boss, because she is only interested in progress in research, and I can do that fine without any compromise in my beliefs.

I'm not criticizing you for having your opinion. I'm showing you how you're not in a position to judge about open-mindedness, when your position on God so obviously clouds your judgement.

You started this. The victim thing is just embarrassing. And if you choose to avoid following proper scientific protocol in your science because of your beliefs, then it better bother your employers. I don't actually believe you're a scientist. And if you are, I don't actually believe you operate like you say people should operate. I'm sorry, but I don't believe it. Because those of us who work in the industry would tear apart every piece of work you do if you were avoiding exploring certain aspects because you started with a foregone conclusion, which is often what you've claimed.

And if you can show me where I have rejected empiricle evidence because of my opinion of God, I will thank you. But I don't think you can, because I don't think I have.

Amusing. Let's see. Radioactive dating. And you admitted you didn't know what the hell you were talking about and made all kinds of assumptions. Now, it's possible that your rejection of such thing is just coincidence, but it's a very convenient coincidence. Evolution. You have yet to show any actual scientific flaws in evolution, while saying things like it espouses a single ancestor (that's abiogenesis and it's only one of many theories regarding it) and that it says we evolved from apes. You've made several ignorant statements that are common Creationist misconceptions and when pressed your science falls apart. I find your claims more than a little difficult to believe.

Indeed. I agree. Perhaps it would be even more miraculous. But it isn't necessary to hold to that position, and I suggest that if you are, you are limiting God quite a bit.

Yes, I'm limiting God to an all-knowing, all-powerful being that has no need to correct his mistakes with regular tweaking like someone driving down the road. You require further action and I believe a perfect being would have no need for such little corrections. I don't say that he can't interact with the world, only that he doesn't need to simply to make me feel comforted. I think it's amusing that you would twist such faith in the ability of God to address the world as a limitation while you claim that the only way God can comfort you is to directly impact you. It would be more amusing if you were kidding, but, hey, I can't have everything.

I appreciate your efforts. And I must say that you seem to have improved your manners, since when I first encountered you, I can remember wondering whether you really did take Jesus' words seriously about loving your neighbour, not to mention your enemy.
Then you're not going to like this post. I'm open. I'm blunt. And I pity you. My bluntness has nothing to do with my love for you or your claim that I lack it and I don't view you as an enemy. I think being blunt is important with an opponent, however, because you clearly try to spin everything and anything even remotely tactful appears to be completely lost on you.

I started out polite in our other conversations, but we ended up right where we are now. With you spinining and spinning and simply play semantic games to pretend like your purposes are different than they are. I don't think you are what you claim you are. I don't think you believe what you claim you believe. I don't think you know what you claim you know. And there is a mountain of evidence for my beliefs in every thread I've seen you in. If you're trolling, you're not very convincing.

And if I'm wrong about you, then perhaps you should evaluate the way you present yourself, because I know for sure I'm not the only one who can see the blatant inconsistencies in your claims and your knowledge, not to mention your behavior.

I doubt anyone but you and I are reading at this point. You don't even notice the progressive clues we give you that we're becoming frustrated with the way you weasel out of points by bastardizing terms or pretending you meant something else or pretending because you said something that the statements we are reacting to that evidence something else must be our problem or a million other activities normally associated with trolling. It's exhausting and disappointing and what you perceive to be rude is the progressive reaction of people like myself becoming more and more tired of trying to tell you we don't believe anything that you say without being pricks about it.

Interesting that you ask. For example, something I was thinking about the other day was natural selection explaining bee hives. In a bee hive, there is one reproductive insect, the queen, while all the others are drones. No doubt the fact that they are drones does help survival. But natural selection works at the level of the individual. Anything that is truly unselfish, that does not benefit the individual in some way, does not really fit in with natural selection being a major cause in the development.

False. This is a misunderstanding of the concept. The purpose of selection is to improve the species. Babies do not benefit the individual.

Now, I know very little about the insect world, and I probably should have done some research before posting my thoughts for all to see on NS. But I wonder how an evolutionist would explain this phenomenom.

There is no such thing as an evolutionist, first of all. Second of all, they would use actual selection principles and not your misunderstanding of them.

Actually, if I turn to my own area of experience, such as bacterial genetics, I can think of several situations where evolutionary theory is either lacking or weak to explain the phenomenom, such as shrinking genomes (and no evidence of expanding ones).

Also amusing. Yet another reason I don't actually believe you are what you say you are. How one can claim to be a scientist and have their only views on science be those that one would find in the average creationist propaganda book is beyond me. Certainly if you were actually working in your field someone would have corrected you on your views of selection and genomes.

Certainly if you were actually working in your field someone would have corrected you on your views of selection and genomes.

Ummm...Does that mean you're going to?

Ummm...Does that mean you're going to?

I did. He ignores it. He has said several times that the thinks selection is active process of choosing and that it is at the individual level rather than as a species (which of course would be counter to just about everything we know about it. What good would it do if one individual was successful if the entire species became extinct).

As far as the genome thing, GnI and Dem have been correcting him for several weeks and it has seemed to not make the slightest dent in the God armor.

I've heard ID'ers make the argument that the universe itself is a closed system and therefore the second law can be applied to the universe and everything within it. Or something like that.

This is true. Though the details do depend upon where one is demarcating the universe. The vacuum, brane, manifold, space, etc. is a fixed but unbounded closed system, by definition unbreachably separate from other similar spaces in a lower-dimensional context.

Within vacua (dimensional spaces), you have conventional universes: the light cones of Big Bangs. These universes, such as ours, are expanding, bounded closed systems. The Big Bang's light cone is a finite closed space containing a fixed amount of heat. This means that from the perspective of a theoretical external observer (which is actually a physical impossibility; you can't be external to a light cone and observe it, but whatever) capable of simulataneously viewing the entire universe, the Second Law is constantly and rigidly true. Entropy always increases.

BUT, this is not relevant to the argument IDers are trying to win. While it is absolutely true that our universe is a closed system, and thus affected on a global basis by the requirements of the Second Law, this does not extrapolate to the Earth, the arena of the formation of terrestrial life. The Earth is not a closed system. It's really much like a refrigerator: it appears to produce net negative entropy and violate the Second Law, but in fact produces so much waste heat that the larger system - the kitchen or house or whatever - obeys the Second Law.

You could also compare the Earth to a heat engine. It runs off of the flow of energy from the Sun to deep space. As the Sun radiates, it spews energy in a massively entropic flow that distributes its energy into the cold void of interstellar space. In between, the Earth 'runs' off of this flow, just like an engine, in a process that ultimately increases the net entropy of the flow.

This argument can also be used in the context of the universe: galaxies seem awful complex, right? And since they are large components of the total mass and energy of the universe, this seems closer to a global violation of the Second Law. But again, not so. The primordial singularity exploded, and its ejecta shell - the mass of the universe - is engaged in the entropic process of spewing its energy into the unbounded void of the vacuum. The formation of stars, galaxies, etc. is a temporary byproduct of this, and again one that ultimately increases entropy.

So bottom line - the use of the word 'global' in the Second Law of Thermodynamics is vital, because it tells us that it only applies to the only truly closed system - the entirety of the universe. No subset of that ultimately macroscopic context is a truly closed system. That includes everything from refrigerators, to planets, to galactic superclusters.

They are narrower, simply because they have one less option. But I don't dismiss the other side. I simply disagree with them.

So when you say your God exists, "no questions" as "found truth", that doesn't dismiss the other side?


I have been saying that they *do* preclude God. They rule him out.
(I get the distinct feeling that you are misreading my posts when I have to repeat myself so often, SC. I'm sure you don't intend to do that, but it sure looks that way.)

I, on the other hand, do not assume either a miracle or a natural force, but allow for both. They have one less option than me.

But you include both necessarily, not allowing for the absence of the "miracle", which is just as narrow as not allowing for the presence of it.

Its like saying that if I state that the universe was created by other-dimensional aliens as a graduate project, I'm now allowing another option, so am now even less narrow than you, since I have one more option.

The fact is, you state as a "no questions" fact that God exists and intervenes, which means you do assume miracles.

Or is this an area where you can excuse a statement as "personal conviction"? Are the scientists who exclude God, "no questions", not entitled to their own personal conviction? Is their unpresentable "personal evidence" not as good as yours? After all, theirs makes them narrow while you feel yours doesn't.

I love science, its methods and fruits, but I have learned to be wary of scientists who claim to be able to dismiss the idea of God(s) categorically. I must thus be equally leary of you, their mirror image.


Because my declaration is based on personal evidence, the sort that I cannot use to convince you or anyone else. In science, on the other hand, you have to be able to support every assertion and conclusion with public evidence and a reasonable argument. That's the difference between a personal conviction and science.

I suppose you could say that. I know my mother, and you don't. Therefore, since I insist that she exists (although I cannot prove it to you), you might think me narrow, and you might be right. But my 'narrowness' is based on my personal evidence of God, while the 'narrowness' of naturalism is based on an assumption.

So is the existence of your mother a "personal conviction" or "science"? Using belief in her as comparable to a belief in God really does show some bias on your own part.

Also, I hope you understand that, the fact of the net aside, were it necessary, I believe you could establish your mother's existence to a reasonably rigorous degree of science...

Proof is for mathematics and alcohol. You claim to be a scientist, yet you don't seem to grasp that concept. Where'd you get your degree? Patriot University?

While I would shudder to anger the Great Old One, let's disagree without being disagreeable, yes?

I think Bruarong's position here might be flawed, but jumping on alma maters might be a bit off sides.

In SCIENCE, no functions are assigned to God in the natural world. That does not mean that a scientist cannot believe that God has interacted or does interact with the natural world. It simply means that a scientist who believes as such cannot use science to study that belief.
*snip*

Demp, I know we disagree on several aspects of science, but in this case I think you've made a very critical, cogent point.

A physicist friend of mine from Wurzburg (sic?) is fond of saying that it in no way diminishes his God that He chooses not to communicate through the laboratory.

*much snip*

Amusing. You started with the narrow-minded stuff. Now, you argue that it's not narrow-minded. Here's the point. You think things work a certain way in regards to God and you say scientists who don't are narrow-minded. The fact is the scientist who simply accepts that he cannot explore such a thing with science is the only one accepting all possiblities on that front. YOU are not. It's that simple. Stop trying to twist and turn and simply admit that your discomfort with science is that the currently and roundly accepted theories don't support your personal views and you wish they did.


Wish I'd said that, 'cause its laser-guided precise.

Yes, absolutely. I've said so explicitly. I believe that God interacts with the universe through the laws he created.

But doesn't that mean you have limited God in your idea of him?



I don't actually know that, nor do you. I can guess, but I don't ascribe anything to God. God either did or didn't.

But you just did say explicitly that God interacts with the universe, and now your are saying that you don't ascribe anything to him.



You have limited him. You have said that if one claims his interaction was as I describe then one must be denying him the ability to interact with the universe. Shall I quote you?

Perhaps you should.


You keep saying one is more narrow than two, but you don't recognize how you are narrowing the ideas you are calling the 'two' and ascribing an artificial narrowing when describing the 'one'. You also keep claiming no limitation, but whenever anyone suggests particularly things you claim it can't be so.

That just looks like 'twisting' on your part. I simply allow God to have interacted both through natural means and miracles (by which I mean non-natural means), while you are allowing that God only interacts through natural means. Who is doing more narrowing?


You amuse me. And I don't mean that as a compliment. You keep trying to make this claim of being open-minded while saying that God must have done something a particular way in order for it to qualify as involvement. Again, do I need to quote you or can you follow your own argument?

Once again, I think you do need to quote me, for I can't remember saying that God must have done it in any particular way. I think you are trying to put words in my mouth. And whether God currently interacts with the universe, or only at the very beginning to set things in motion, either way would make him the creator.


You have limited God. Do I believe that God can involve himself in the daily lives of people? Yes. Do I think he MUST do so through immediate involvement rather than through a long slow process he knew would result in our comfort? No. Only you require that limitation.

I have never said this. I have simply said that I believe that I have recieved comfort, among other things, from God. If that is a limitation, it isn't based on wishful thinking, but experience, or what I think has been my experience.


You accept the involvement of One God in One way and you openly admit to doing so. We see you be close-minded and you have openly admitted that you would not look for certain types of explanations if they don't match up with what you believe, because you've decided they do not exist.

I would suggest that any rational person would do this. We no longer examine alchemy as a way of making gold, not because we have *proven* it can't be done, but because no one really thinks it can be done as an economically viable option.


You've claim ridiculous kinds of proof are necessary (like a time machine) to avoid admitting that you simply aren't willing to accept the possiblity of certain outcomes. Keep claiming you're open-minded. It won't mean you ARE open-minded, but, hey, perhaps no one will notice.


It might look that way from your point of view, I can understand, but from my side of the argument--I have never suggested that I am open-minded. I have my opinions, and I am standing by them. You can claim that I am narrowminded all you like, but you haven't demonstrated that yet.



No. Good is an opinion. And, no, I don't suspect that God would want you to limit him in that way. God is everything. Good is a human restraint. God just IS. If we describe everything associated with God as good and the absense of God as bad, then that's just a line we've drawn in the sand. It has nothing to do with what God is. I don't believe God is good. I believe good is God.

All good is God? When you do good to someone, that good is God? That doesn't make much sense, does it? I would say that God is love, but that doesn't mean love is God.


It means you've painted him with that requirement. Making him sometimes react rather preempt makes him a reactionary. According to you the only way he could have made you feel comfort is immediate involvement. According to you it requires a supernatural involvement, while most of us admit that if God started the universe in motion with the plan that natural forces would make you feel that comfort, no supernatural explanation required while God did it. No limitation. However, you require God to have supernaturally MADE you feel good and claim that a natural explanation is insufficient. If God made natural forces have that effect on you, then the natural explanation must by default be there. By denying it, you limit God to a different role, a role of reactionary, rather than planner.


I would say that I base my opinions on God on my own experience of Him and on the Bible, and the experience that others have of him. If the Bible is to be believed, the claims in it are limited/defining/describing God. For example, when Jesus says that God is our Father, would that be a sort of limitation of God? Obviously. Knowledge does bring us definitions, and definitions include limitations.

I don't think that the comfort that God gives can be explained in terms of natural forces. God's Spirit is hardly a natural force.


No, the comfort they got from them would be from the belief. If that belief is a result of how we were designed by God, then the belief would also be from God. Just because you get meat from animals, does that mean God doesn't feed you?


It looks like you are limited God to using natural forces only. In the Gospels, we have accounts of Jesus turning five loaves and two fishes into much much more. I accept that this account could be literally possible. Do you?

And you seem to be saying that the comfort one gets from belief in God does not actually come from God, but the belief. So, in other words, believe that God comforts you, and you may not recieve comfort from God, but you will recieve comfort from the belief. I am suspecting that you can't really tell the difference. Could it be that you have not really experienced God's comfort, and that you have found comfort in something less than God?


We get everything from God if God created the universe. Everything. That he would have to actively involve himself in your piddly existence because he didn't already know your needs before your existence was even on the horizon is absurd.


I don't think my existence is piddly to God, or yours. That wouldn't match the great sacrifice of Jesus. And I do think God has reacted to our circumstances in sending Jesus. Otherwise, he planned all this evil mess that we are in, right at the beginning, instead of reacting to our situation and coming to our rescue.


Clearly, you're struggling here. Let's say the universe is a closed system. Let's say we can analyze it as far back as it's ultimate arrival on the scene, time and all. Let's say we eventually know everything about it and it's nature. Still doesn't eliminate God. Because God is outside nature and the universe and created it and all it's laws. He is also is outside time, so he didn't do it before the universe or after the universe or during the universe, but he simply did it. Becuase he has not limitation of time he knows the outcome of everything he does as he does it. There is no need for tweaking.


But this idea leaves no room for free choice. Sure, God knows what will happen in the future, but does that mean he is the cause of everything outside of our control. Did he cause my little niece to be born without lungs? Did he create AIDS?
I understand that we humans are limited in our concept of God, partly because we are limited by time. But I don't think you idea of time not limiting God solves your problem.


Everything will have natural laws explaining them because God made it that way and, yet, everything is still a product of God. God will still never be a part of the scientific explanation of the universe nor excluded from it, in that scenario, yet will be responsible for every bit of the happenings within.


Thus you are then in a position of saying that everything in the universe can be explained using natural laws. But since you are a Christian, you believe that a human has a spirit. Thus, is that spirit a natural thing, or a spiritual thing?


Creationism in common usage is in conflict with current science. I don't believe that. I believe everything in the universe can be naturally explained. And I believe that God does not have to tweak the universe. If you agree with me, you are perhaps the worst communicator I've ever encountered.


I don't believe that everything can be naturally explained. When someone encounters God, the real God who is capaple of revealing himself to us, natural explanations don't fit. I argue this from both personal experience and from what I have seen and heard in others. What makes it more convincing for me is when I compare the effect of the revelation of God to the effect of natural laws. There is a world of difference.


Seriously, I've seen very few people who weren't simply trolling who dance around the ideas as much as you do and make as many claims about open to certain concepts while simultaneously rejecting them on little more than "I don't understand them so I don't like them." You dismiss radioactive dating while admitting you don't understand it and referring in all sorts of eroneous ways. You dismiss evolution while arguing about abiogenesis (even though it's a seperate theory) and referring to man as having evolved from apes. You claim to be open-minded and then say that unless you accept a certain way of viewing God (and only your way of viewing God) then people must be refusing to allow for certain ideas.


I don't dismiss radioactive dating, or evolution, or even abiogenesis. You are trying to paint me that way. That's called pigeon holing. I wish you would quit it because it just raises a great cloud of smoke in this debate. Why do you do this, Jocabia?


It's become more than ridiculous. If you'd like to continue to debate. Start here. Clearly and openly express your views. Then *gasp* actually behave like you believe them. And before you make claims about a certain scientific view, actually understand what it says. Saying that you're a scientist and then saying evolutions says we evolved from apes is just embarrassing.


Firstly, I believe in God. I believe that he is responsible for the world and the universe. I believe that God is capable of using both natural forces and supernatural forces to accomplish his will. I don't know how God brought the universe about, so my faith doesn't help me much in that regard.
So I look at the finer details and examine the ideas of those who are trying to explain everything in terms of natural laws. I accept or reject ideas on their merits. If I reject macroevolution (I don't totally), it isn't because my faith requires this, but because I think it doesn't work, mechanistically. Obviously, I don't know all there is to know, so I am limited by my ignorance. I can only express my opinion based on what I have understood, not on what I haven't.

As for mentioning that humans may have evolved from apes, it isn't a scientific statement. Apes, in that sense, refers to the prehuman ancestor (if there was one). It need not imply the modern apes, in the strict taxonomic sense. I don't find that embarrassing, since it was an informal reference to an ape-like animal. Evolution theory certainly has it that humans evolved from some hairy smaller brained animal. It may not technically be an ape, but for the purpose of a point I was making at the time, it was irrelevant.

What is more embarrassing perhaps is your endless going on and on about it, aparently for the purpose of trying to make me look bad. Why else would you bring up an irrelevant point from a thread that was months old already? Which makes me wonder why I bother replying to your posts.


Amusing. You started with the narrow-minded stuff. Now, you argue that it's not narrow-minded. Here's the point. You think things work a certain way in regards to God and you say scientists who don't are narrow-minded. The fact is the scientist who simply accepts that he cannot explore such a thing with science is the only one accepting all possiblities on that front. YOU are not. It's that simple. Stop trying to twist and turn and simply admit that your discomfort with science is that the currently and roundly accepted theories don't support your personal views and you wish they did.


I actually never said that scientists who rule out creation are narrow minded. Yet another example of your putting words in my mouth. I said that they considered one less option than I did, and that would make their views more narrow than mine.


You're just being silly. Really, really silly. You're narrow-mindedness is based on what you believe. You believe it's true of course and that plays into your personal experience but the fact that you treat it as if it's true is narrow when the fact is there are other possibllities and you are not addressing them.


But I do adress the other possibilities. You have no idea of what I have or have not addressed, except for what I have posted on NS. I think it silly of you to assume that you know what I have or have not addressed. Not only that, but you have your opinions as well. Does having them mean that you have not adressed the alternatives, because you have your opinions?


If God did exist a belief in pink bunnies would still serve the same purpose. However, if God does exist the comfort is from the idea (a natural explanation) and from God (a supernatural explanation. The existence of God does not change the natural role of the idea.


I disagree. I think a sincere belief in pink bunnies being a source of comfort would not mean that the believer recieved comfort from God, but comfort from his belief. Obviously, I see the comfort from God as more than can be explained through natural forces. His spirit is the great comforter that Jesus sent to us believers.


No, I'm not. His interaction is outside of time. His interaction is forever. It's always. Every moment. It's all directed by his design. Meanwhile, the explanations are perfectly natural. That's the way it was designed. It makes faith a requirement. I'm not restricting God. I simply recognize that either way, there would be no evidence of his involvement, so anything I believe is no more than a guess. I simply don't operate off the assumption that a natural explanation for everything in the universe is not available. Doing so would limit God. Does it mean I will have that explanation? No. It doesn't mean I shouldn't look for it.


I don't see how having only natural explanations makes faith a requirement. You might like to explaine that one.

And if you think that God did not create the world, or that he could not, then you have limited God. And if you assume that there is no evidence of His involvement, how would you know this? Could it be possible that we discovered some evidence for this tomorrow? Or have you already ruled out this possibility?

And by the way, if you refuse that assumption that a natural explanation for everything in the universe is not available, does that mean you are assuming that a natural explanation is possible for everything?



You, on the other hand, have said that he MUST have interacted with the universe since its origin and you actually think we should treat theories in science as if they are looking for something that doesn't exist because some things were God's hand.

Yes, I do think God has interacted with the universe. I think Jesus is God, and that he came to earth. But since I think God uses both miracles and natural forces, I am not assuming that he created man as man.

If I reject a theory in science, it would be because of my understanding of the mechanisms within that theory, not because of my faith.



You try to hide that belief in weak language, but you've admitted it before. You believe science by not expecting certain things to be the work of God and ignoring them is seeking to replace the work of God as an explanation with a wrong explanation.

I'm not hiding, not pretending, not trying to pull the wool over anyone's eyes. If I think that science is seeking wrong explanations, it would be because of the details of the explanations, not because of my idea of what God can and cannot do. You obviously don't believe me, but that would be because you have already made up your mind that I am hiding or even lying, and you don't seem to be hearing what I am saying anymore.


Your recent claims otherwise, don't actually evidence any actual change in your methodology. You play semantic games to pretend to be open-minded. "I didn't radioactive dating flawed. I only pointed out the flaw in it (without saying that so I can claim I didn't say it)."


This is not a game, Jocabia. If anyone is playing it is you.
I have never said that radioactive dating is flawed. You keep trying to put words in my mouth, desite my addressing that several times already. I said that the method works fine, but it is based on an assumption, and one cannot use the assumption to prove an old earth. It can find dates that are consistent with an old earth, sure, but having these numbers does not prove an old earth. In an old earth scenario, the date-finding is OK, but if the earth isn't so old, we would have a method that is successful at finding figures, but that these figures do not represent actual years.


Still doesn't mean that there is no natural explanation. Is God so limited in your eyes that he can't make you experience all the things you experience through perfectly natural means? It's amusing that you keep saying that my beliefs are possible and then claiming that something has to either be from natural means or from God as if they are in conflict. This is the same point Dem is replying to. Either you believe natural explanations cannot also be Godly explanations or you are really bad at expressing the concepts you're trying to espouse.

I have not been saying that there is no natural explanation. I have said that I can see the difference between the comfort that comes from belief, and the comfort that comes from God. Sure, God uses natural forces, but not only natural ones.



Amusing. You try to equate a bunch of existential philosophies with your defense of your position. Amusing. It doesn't make those things any more direct than you've already claimed. It doesn't make your evidence any more emperical. It simply shows that you're struggling to defend your denial of basic scientific principles so you're trying to turn the whole argument on its ear. The point is that there are natural explanations for your 'supernatural' evidence. It doesn't mean that when one accepts those natural explanations they must reject God or reject the entirety of reality. In fact, it's accepting that it is God's hand that is more along the lines of your examples here, because it requires nothing more than a belief.


I'm glad that you find something amusing in this tiresome debate, in which I keep having to repeat myself. You do things like accuse me of denying basic scientific principles, but you don't bother to demonstrate (or you can't) how. It shows me that you don't really understand my position, and perhaps that you don't even understand your own. Maybe you just like slinging mud.
You are the one that is trying to say that there is a natural explanation for everything, that any supernatural explanation is false. While I allow for both. And then you say that I am being narrow about it.


You are so obvious when you're trying to avoid the point. You keep treating science as this naturalist mass. You claim you don't, but you bring it up in every thread. And then you use fringe examples as if they represent the general populous of science or scientists. It's just silly. Science looks at what is within it's realm of study. It's not a denial of God or the supernatural. It's a limitation of our ability to explore the world using evidence. You claim that naturalism is damaging pure science, but you have not shown in any way at all how that is occurring and every time we press you on it, you say something weird like this to pretend like we're talking about something else. I'm a patient man, but this is too much.


I don't look on science as naturalistic. I see naturalism as a relative new-comer. True science does not need naturalism. I am perfectly capable of doing science without naturalism. And yet the idea that everything can be explained using natural forces is one of the mainstays of naturalism. I don't claim, however, that naturalism is damaging science, although it may be limiting science. For example, if science is about the search for truth in a material world, and if God did interact with the world, then naturalistic science would never discover this. It would simply assign a natural explanation rather than the right explanation.


Frustrating. We're talking about science. You put your beliefs about God into your science (although whenever we press you, you claim not to). That's narrow-minded.

Why is that narrow minded? I have already said that my beliefs in God do not rule out natural causes. Belief in God is limiting God, perhaps, but not my search for truth in a material world (i.e., my science), which is what this debate is really about.


Having beliefs isn't narrow-minded. Suggesting that everyone else who doesn't hold your beliefs and who doesn't approach things in the way someone of your beliefs would IS. You said at the outset that scientists who don't consider supernatural explanations in their activities are narrow-minded. Now you've managed to spin that into making out like we called you narrow-minded. We did eventually, but it was because you were suggesting that everyone who doesn't think like you is wrong.


But I don't say that everyone should believe what I believe, nor am I saying that my way is the only way to do science. You are just making that up.

I have never called scientists who are naturalists narrow-minded. I said that they consider one less option than I do, thus their options are narrower than mine. And I didn't have to do any spinning to show that you are calling me narrow-minded, as you just admitted in your next sentence.


I'm not criticizing you for having your opinion. I'm showing you how you're not in a position to judge about open-mindedness, when your position on God so obviously clouds your judgement.


You thought I meant something, and what I am explaining is that I did not meant it that way, and you are not listening to my explanation, but are just holding onto your convinctions.


You started this. The victim thing is just embarrassing. And if you choose to avoid following proper scientific protocol in your science because of your beliefs, then it better bother your employers. I don't actually believe you're a scientist. And if you are, I don't actually believe you operate like you say people should operate. I'm sorry, but I don't believe it. Because those of us who work in the industry would tear apart every piece of work you do if you were avoiding exploring certain aspects because you started with a foregone conclusion, which is often what you've claimed.


Everyone has foregone conclusions. I just happen to have a different one from you. And you are entitled to criticise it, since I have placed it on NS for public criticism. Obviously, you don't like my approach, but honestly, I don't see much value in your criticisms, since it seems like I have to spend most of my time actually correcting your misunderstanding of my position or your persistance in putting words in my mouth.

I don't care whether you think I am a scientist or not. It's irrelevant. I don't care what you think of me. I'm here to learn through discussion and debating. And if you won't discuss like a civilised person, I will ignore your posts, since they are a waste of my time.


Amusing. Let's see. Radioactive dating. And you admitted you didn't know what the hell you were talking about and made all kinds of assumptions. Now, it's possible that your rejection of such thing is just coincidence, but it's a very convenient coincidence. Evolution. You have yet to show any actual scientific flaws in evolution, while saying things like it espouses a single ancestor (that's abiogenesis and it's only one of many theories regarding it) and that it says we evolved from apes. You've made several ignorant statements that are common Creationist misconceptions and when pressed your science falls apart. I find your claims more than a little difficult to believe.


I'm not convinced that you know what you are talking about. A single ancestor is a mainstay of evolution, not abiogenesis. Having homology is supposed to be consistent with the idea that life arose as a basic form (through abiogenesis, chemical evolution) and then developed into more complex forms (through biological evolution). Read any explanation of evolution, and you will see the reference to a simple ancestor, since it explains homolgy.

In this particular debate, we have not been dealing with the flaws in evolution. But we can go there if you like.


Yes, I'm limiting God to an all-knowing, all-powerful being that has no need to correct his mistakes with regular tweaking like someone driving down the road. You require further action and I believe a perfect being would have no need for such little corrections. I don't say that he can't interact with the world, only that he doesn't need to simply to make me feel comforted. I think it's amusing that you would twist such faith in the ability of God to address the world as a limitation while you claim that the only way God can comfort you is to directly impact you. It would be more amusing if you were kidding, but, hey, I can't have everything.


I was under the impression that you thought that everything in the material world can be explained using natural forces. That means that God didn't interact with the material world, except for using natural forces, and that his interaction is limited to the original event of creating those natural forces. Are you changing your original position?

It's my experience in life tells me that God does interact with the world, not my wishful thinking.


Then you're not going to like this post. I'm open. I'm blunt. And I pity you. My bluntness has nothing to do with my love for you or your claim that I lack it and I don't view you as an enemy. I think being blunt is important with an opponent, however, because you clearly try to spin everything and anything even remotely tactful appears to be completely lost on you.


If that were accurate, I think I would enjoy your posts. But I feel that you are simply not understanding my position, judging by the number of times I have had to correct your misunderstandings about my position, and the number of times I have caught you trying to put words in my mouth.


I started out polite in our other conversations, but we ended up right where we are now. With you spinining and spinning and simply play semantic games to pretend like your purposes are different than they are. I don't think you are what you claim you are. I don't think you believe what you claim you believe. I don't think you know what you claim you know. And there is a mountain of evidence for my beliefs in every thread I've seen you in. If you're trolling, you're not very convincing.


We could end up trading insults, but I would rather not reply to your posts at all than go down that road. Better to spend time replying to people who do not assume that I am spinning, who do not get personal, and who are not so frustrated.



And if I'm wrong about you, then perhaps you should evaluate the way you present yourself, because I know for sure I'm not the only one who can see the blatant inconsistencies in your claims and your knowledge, not to mention your behavior.


Yes, you are right, I should evaluate the way I present myself. But I do this all the time anyway. Do you? I see your posts as not only blunt, but also insulting and ridiculing. It sometimes looks like you resort more to bullying than intelligent arguments. Did you want to come across that way?


I doubt anyone but you and I are reading at this point. You don't even notice the progressive clues we give you that we're becoming frustrated with the way you weasel out of points by bastardizing terms or pretending you meant something else or pretending because you said something that the statements we are reacting to that evidence something else must be our problem or a million other activities normally associated with trolling. It's exhausting and disappointing and what you perceive to be rude is the progressive reaction of people like myself becoming more and more tired of trying to tell you we don't believe anything that you say without being pricks about it.

Your frustration could be due to your inability to find the flaws in my position, or it could be due to the inadequacy of your own position, or it could be due to something else that I have not thought of.

I am not pretending. I have tried to clearly communicate my own position--as clearly as I can. And I am still learning how to do this.

And there is simply no excuse for being a 'prick'. Don't blame me for your own weaknesses. In fact, you are quite simply one of the most rudest debaters on NS, judging by the number of insults that have come my way. I think you ought to take a good look at yourself. Many of those who don't call themselves Christians have more manners than you.

In conclusion, either improve your posts, or don't bother replying to me, because I certainly shall not be wasting my time on replying to your insults.

IMO, it doesn't have to benefit the individual, just their genes...but wait, how exactly are they not individually benefitting from being drones?

Oh, so you have heard about Richard Dawkins' idea of the selfish gene? That we shouldn't look at the effects of natural selection at the level of the individual, and it's effort to survive, but the level of the genes, and their 'need' to survive. I think he does have an interesting suggestion here, and it would appear to solve many problems--in the animal world at least. But human behaviour does not fit with this concept, since humans are capable of all sort of unselfish acts, many of which are directly against the interests of the genes, like priests and nuns, or those who risked everything to help the Jews during the holocaust. Even religion itself that points to a home in heaven is often resulting in actions that work against gene survival.

But back to the bee drones scenario, I can see how natural selection would prefer some bees to be drones...since this would enhance the survival of the hive. But how did this sort of thing develop/evolve, considering that natural selection was supposed to have selected for genes that were not being passed on, i.e. the genes in the drones. I find this counter-intuitive, but perhaps not unexplainable. What it might mean, though, is that an evolutionary explanation for this has to resort to ideas that we have no evidence for.



Oy...I dunno much genetics...Have you ever been able to tell what's leaving? maybe it's just some nonsense...I would really know, all I get is the basics of intron and such in school.

Then I will keep it simple. And I did not come across this in any creationist web site, but found it in my own readings of scientific journals.

The idea is that we have discovered that bacterial genomes are getting smaller. Mostly, you are right, it is the 'junk' that is leaving, since 'junk' DNA is expensive to replicate, and a lighter genome is an advantage. Thus, consider a gene that codes for a protein. When that protein is not needed under certain conditions, the gene is switched off. It becomes a silent gene. If the organism can survive without the silent gene, it may as well get rid of it, since it only costs the organism more energy. A classic example is Mycobacterium leprae, the bacterium that causes leprosy. It is thought that thiis bacterium was once capable of survival apart from the human host. Nowadays, it cannot survive without the host, and the explanation is that when it lives with the host, it no longer needs those genes which enable it live independently of the host. Thus those genes are lost, to avoid the waste of energy into replicating them. Over time, it became incapable of the free living form.

Now, the mechanism for losing DNA is varied. Mostly it seems to be through copying mistakes, in the bacterial world. (In humans, there seems to be a precise mechanism, but I'll leave that out for the moment.) The end result is typically less DNA. But copying mistakes should also theoretically result in the increase of DNA too. But since the increase of DNA means more energy requirements, unless the increase in DNA provides some sort of selections advantage, it will eventually be lost. Thus, as we would expect, bacterial genomes are becoming more and more streamlined, more specialised, and less able to cope with a variety of environments.

But while this is what we would expect from natural selection, it doesn't provide us with answers for evolutionary theory, since the theory has it that all of life today has evolved from some more simpler life form that no longer survives. Evolutionary theory does not rule out simplification, but it certainly does expect some increases in complexity, since this is the general message when looking at the evolutionary trees that they like to construct. Evolution is widely thought to involve the process of complication, or an overall increase in complexity. Mechanistically,though, this does not seem be very common. In fact, there doesn't seem to be any good examples of organisms that are in the process of becoming more complex. Speciation would appear to be through a loss of information (e.g. genes) rather than through a gain.

Natural selection selects bacteria that aquire a resistance to antibiotics. Some cases of resistance are where the bacteria aquire a resistance gene encoded on a plasmid. Isn't this an example of an increase in genome? Actually, yes, it is, and it is one of the examples of the mechanisms that does this. But apparently even this example is not enough to grow the genome, since it is advantageous for the bacterium to lose the plasmic once the antibiotic resistance selection is removed--since having more DNA to replicate at cell division is more expensive and slows the rate of cell division.

So is the shrinking only in the bacterial world? Not at all. It seems to be found right throughout life. How does evolutionary theory explain this?

Oh holy hell....

If during the long course of ages and under varying conditions of life, organic beings vary at all in the several parts of their organisation, and I think this cannot be disputed; if there be, owing to the high geometrical powers of increase of each species, at some age, season, or year, a severe struggle for life, and this certainly cannot be disputed; then, considering the infinite complexity of the relations of all organic beings to each other and to their conditions of existence, causing an infinite diversity in structure, constitution, and habits, to be advantageous to them, I think it would be a most extraordinary fact if no variation ever had occurred useful to each being's own welfare, in the same way as so many variations have occurred useful to man. But if variations useful to any organic being do occur, assuredly individuals thus characterised will have the best chance of being preserved in the struggle for life; and from the strong principle of inheritance they will tend to produce offspring similarly characterised. This principle of preservation, I have called, for the sake of brevity, Natural Selection.
Bruarong,

One will notice the summery of Chapter 4 starts off with Natural Selection being formulated as an argument. Where is the flaw in the reasoning? Where is the step that demands magical intervention? Clearly, to you, this argument is without a keystone, being improbable into impossibility without meddlesome magic by a god so imperfect he can't set the table of the universe right the first time. Reveal this hidden flaw plainly, or admit the only imperfection to be found for those assembled rests within your personal willingness to demand, and accept unseen, magic compensation in lieu of practicable understanding.

Oh holy hell....


Bruarong,

One will notice the summery of Chapter 4 starts off with Natural Selection being formulated as an argument. Where is the flaw in the reasoning? Where is the step that demands magical intervention? Clearly, to you, this argument is without a keystone, being improbable into impossibility without meddlesome magic by a god so imperfect he can't set the table of the universe right the first time. Reveal this hidden flaw plainly, or admit the only imperfection to be found for those assembled rests within your personal willingness to demand, and accept unseen, magic compensation in lieu of practicable understanding.

I have no problem with the concept of natural selection. However, when I see natural selection failing to bring about necessary changes, changes that evolutionary theory requires, am I not being fair in pointing out this inadequacy?

I am not demanding a magical explanation, nor am I even arguing for one in this instance. I am simply pointing out the inadequacy of the current evolutionary theory--which means that I am justified in my skepticism of it.

One can criticise evolutionary theory, don't you think?

I don't like that analogy. It isn't like what we are dealing with. In abiogenesis, there isn't an intelligent life than can recognise intelligent information (like you are recognising the shuffled cards).

Exactly my point! It doesn't become information until something begins to use it. Which means that the exact same complexity could not be information now, but could be information tomorrow.

At any rate, that makes more sense then 'finding' a use, since inanimate ojects are acted upon, rather than finding uses for patterns.

The method in which they are 'acted on' could mean that a use for a pattern is found.

It would depend on how you designed the computer program. You might discover something about the nature of waves and sand. I doubt you would find anything that would help code for a lipid synthase. At any rate, you have supplied a program, and that makes you a designer. Still not a good analogy, Dem.

I didn't design the information. It was already there. The computer program is simply an example of something that could "read" the information. Another example would be certain enzymes....

But since sequence is more likely to be determined by available building blocks at the polymerisation site (rather than any other factor), the complexity is not going to be information.

It isn't information at first. It becomes information once something can "read" it. A bunch of random zeroes and ones means nothing to me, but a computer can "read" it, so it is information to the computer. To me, it looks purely random.

Rubbish. It isn't information unless it means something. Unless the sequence serves a purpose, it is meaningless.

But it can be meaningless and then gain meaning when something attaches meaning to it.

By controls, I suppose you mean someting the prevents spontaneous polymerisation. But wouldn't that something be more likely to prevent the rise of information? Would it really be a help or a hindrance to abiogenesis theory?

Like I said, you wouldn't have that something at first - not at the time of abiogenesis. However, once life had arisen, controls would begin to arise as well, through natural selection, because spontaneous polymerization would no longer be beneficial...

If you have ever worked with RNA, you will know how infuriatingly unstable the jolly thing is, on account of all the RNases.

Do you think that RNAses came about before or after RNA?

Meanwhile, even without RNAses, RNA is unstable - precisely why it is more likely as a conduit for the very beginning of life.

I suppose I cannot really demonstrate that randomness cannot create information, but since I have never seen it happen, I remain skeptical.

And yet it happens all the time. All it takes is something to ascribe meaning to the sequence.

I disagree. I think that any primitive DNA replicase or RNA polymerase would be a great disadvantage to the cell

Exactly my point. That's why we were talking about self-replication, and not enzyme-mediated replication.

Quite right. Which means that just having a sequence is not enough. It needs to be specified, because in order for life to survive, there are some basic conditions that need to be met, e.g., a compartment or cell wall that allows the generation of energy, or an electo-potential.

...which is why life would not have arisen from codes that didn't include these things.

No I'm not. I'm saying that it doesn't predict anything about evolution. It is humans that understand the law that make the predictions. The law predicts nothing other than what the description says.

Hmmm, so you admit you were wrong when you said that evolutionary theory goes against the predictions of the SLT2?

My feeling is that if this issue wasn't so important to the God exists/God doesn't exist debate, people would not hesitate to discard to idea of abiogenesis as mere fantasy, science fiction, a modern myth.

Science doesn't care if God exists or not - as science cannot be used to study God.

SLT does indeed predict that matter will take the most stable energy form, but it isn't the only law operating in the universe. Where we see deviations from SLT, we can explain it in terms of other laws of nature.

Wrong. There are no deviations from the law that we have ever observed. The fact that non-spontaneous reactions occur in the body is not a deviation from SLT2, because we can see where the extra energy that causes those reactions (usually another coupled reaction) is coming from. The overall system never deviates from the law, or we would have to declare the law wrong.

Life itself works against SLT, since it keeps our bodies at a fixed temperature (whereas SLT would mean that our bodies are the same temperature as our environment).

You demonstrate a complete lack of understanding of thermodynamics when you say things like this. SLT2 would not mean any such thing. It would mean that, in the absence of any excess energy, our bodies would either stay at the same energy state or move to a lower energy state. However, with the addition of energy, the SLT2 is clear that entropy can decrease in a subset of an overall closed system.

Next you will be saying that abiogenesis is even likely. Or?

The idea makes sense, but there has not been enough data gathered to say it is supported as a theory.

That is a possibility that I sometimes consider. But what sort of mechanism would you be thinking of?

Any other mechanism. I haven't seen any evidence that another mechanism must be defined, so I can't tell you what it might be. But if such evidence were to be found...

So you think I fail to see that the methods of science are limited to nature?

You have stated that you don't think they should be numerous times.

And incidentally, I have always said that science does not rule out God.

No, you haven't. You have consistently stated that modern science completely rules out God by not including God. Why do you insist on flat-out lying?

Hmmm, that's an interesting idea. But what is the difference between a 'scientific' explanation, and any other explanation?

One is derived from the methods of science. The other is derived through some other method.

I've no problem with people who write scientific papers and that don't include God in them. I do the same. I do have a problem with people who try to argue that science shows that the Bible is wrong, or that God does not exist, since I believe that it does neither.

And I'm sure such people have a problem with those who suggest that the beauty of the Earth is evidence for God. But since neither position is a scientific one, what does it matter in a discussion of science?

Dem, we have been through all this before. I agree with your first statement. And the answer to your question is 'no'.

Yes, and when we went through it before, you argued with that statement - quite vehemently, in fact.

John Doyle......Googling....dynamic feedback systems and steady state analysis.....I didn't find much about complexity arising out of chaos....where did you find that?

In his lectures mostly - which is why I said you should talk to him.

Demp, I know we disagree on several aspects of science, but in this case I think you've made a very critical, cogent point.

Thanks!

A physicist friend of mine from Wurzburg (sic?) is fond of saying that it in no way diminishes his God that He chooses not to communicate through the laboratory.

Awesome! I'm sooooo using that quote!

Oh, so you have heard about Richard Dawkins' idea of the selfish gene? That we shouldn't look at the effects of natural selection at the level of the individual, and it's effort to survive, but the level of the genes, and their 'need' to survive. I think he does have an interesting suggestion here, and it would appear to solve many problems--in the animal world at least. But human behaviour does not fit with this concept, since humans are capable of all sort of unselfish acts, many of which are directly against the interests of the genes, like priests and nuns, or those who risked everything to help the Jews during the holocaust. Even religion itself that points to a home in heaven is often resulting in actions that work against gene survival.


Again - a flawed understanding seems to be your Achilles Bodypart.

If I am a priest (by which, one assumes you MUST mean 'celibate' ones), and my contributions to my community help it to endure (just the same as if I were the shelter-builder), then I am helping the survival of the genes.

Just, not MY genes, perhaps.

One can criticise evolutionary theory, don't you think?

Not if the whole criticism consists of "Well, I don't like it"...

If one simplifies it a lot one could get: more entropy = less order = less complex structures. Which is what the IDers use as argument.

Small problem: the earth is not a closed system.


Take it from a physics student:

entropy is not a measure of heat distibution. If heat becomes more evenly spread (for example ice melting) entropy increases, if heat becomes less evenly spread (for example, your nice frosty beer in the fridge) entropy still increases. entropy is (very basically put) a measure of how much change of temperature there has been, entropy can NEVER decrease only increase because you can't undo a change in heat (Unless the processes is totally reversable(which is not practically possible day to day))


confuse you?
it should cos it confuses the fuck outta me and I've got an exam on all that next week =)

Take it from a physics student:

entropy is not a measure of heat distibution. If heat becomes more evenly spread (for example ice melting) entropy increases, if heat becomes less evenly spread (for example, your nice frosty beer in the fridge) entropy still increases. entropy is (very basically put) a measure of how much change of temperature there has been, entropy can NEVER decrease only increase because you can't undo a change in heat (Unless the processes is totally reversable(which is not practically possible day to day))


confuse you?
it should cos it confuses the fuck outta me and I've got an exam on all that next week =)

Be very careful on your test. Entropy is not a measure of heat, but of energy. Heat is a form of energy, and entropy often increases by heat dissipation, but that is certainly not the only way.

Oh, so you have heard about Richard Dawkins' idea of the selfish gene? That we shouldn't look at the effects of natural selection at the level of the individual, and it's effort to survive, but the level of the genes, and their 'need' to survive. I think he does have an interesting suggestion here, and it would appear to solve many problems--in the animal world at least. But human behaviour does not fit with this concept, since humans are capable of all sort of unselfish acts, many of which are directly against the interests of the genes, like priests and nuns, or those who risked everything to help the Jews during the holocaust.

If priests and nuns are in any way related to the people in their community, the genes "benefit" from them helping to keep others alive.

The idea is that we have discovered that bacterial genomes are getting smaller.

In some cases. In others, they are getting larger. In some organisms, the entire genome is copied more than once. In some, there seems to be an entirely unknown mechanism for saving information from two generations ago.


Natural selection selects bacteria that aquire a resistance to antibiotics. Some cases of resistance are where the bacteria aquire a resistance gene encoded on a plasmid. Isn't this an example of an increase in genome? Actually, yes, it is, and it is one of the examples of the mechanisms that does this. But apparently even this example is not enough to grow the genome, since it is advantageous for the bacterium to lose the plasmic once the antibiotic resistance selection is removed--since having more DNA to replicate at cell division is more expensive and slows the rate of cell division.

And can you not imagine a case in which the selective pressure is never removed? Or the mutations that would remove the excess gene never occur, instead leading to that gene mutating into something else?

Your problem is that you want a theory to empirically demonstrate an example of every possibility within it, but that is not necessary for something to be a valid theory.

This is not a game, Jocabia. If anyone is playing it is you.

Uh-huh. Yes, I notice I've been constantly spinning my position and contradicting myself. Oh, wait that was you. I've noticed that I've been playing word games about how you're not 'rejecting' radioactive dating when you say it's completely wrong because it's based on an unsupported assumption. Or maybe you were trying to say it's right, but it's based on an unsupported assumption. Now, the second idea wouldn't make any sense, but neither does claiming something is baded on an unsupported assumption and then claiming you're not rejecting it. I'm done with whatever it is you're doing. I think anyone who reads this can adequately see the contradictions with yourself you've made.

That would be the conclusion, the 'educated guess', the opinion of the professor who thinks he cannot be so religious as to allow an alternative.

Nothing here suggesting you are calling mainstream scientists close-minded. Unless one actually reads it.

My position is that of preferring open (unanswered) questions than the narrow and exclusive assumptions of naturalism (i.e. that there was not interferrence from God). In other words, I would rather live with open questions than embraced obviously flawed theories. I would rather follow the truth where I find it, than make assumptions that are unnecessary.

Now, here you clearly do (though you'll claim you were only talking about naturalists, amusing as that is). Keep in mind we are talking about evolution and you have clearly stated you think it is a naturalist theory even though the majority of people who hold it are Christian and the it has never been successfully debunked.

And in case anyone didn't notice, you do accuse mainstream science of naturalism despite your denials -

the concept that only natural forces were involved in the 'creation' of life, development of the species, existance of man, etc.
Which is suprisingly hard to find in the theory of evolution.
That's is to say that you have not found it? I am mildly surprised. How widely read on the theory are you? (I don't mean that as an insult.)

Amusing. If one reads the theory and notices that it doesn't mention ANYTHING about God, whatsoever, they must simply not be well-read enough to understand you're unique understanding that the vast, vast majority of mainstream science that accepts evolution are confused by naturalism.

If you read up enough of evolutionary theory, you might not find this spelled out directly, but you will see a complete absense of God, even when there is no sensible alternative. It would be because the writer is unwilling to allow for God, even if he believes in God's existence, because he feels that it would no longer be science if he did--just as Darwin insisted all those years ago.

In the end you admit, the absense of God is your complaint. Yet, you later try to pretend that they are actually denying God rather than simply leaving them out. Yet, even later, when accused of allowing your personal beliefs to color your science you say that you practice science without addressing the fact that you cannot explore the supernatural with it, yet you aren't a naturalist (like you accuse others of being).

They observe natural causes, don't observe God, so they go with the natural (while hopefully not precluding or dismissing God, but not assumptively including him either). You observe the natural, and include God as your assumption, "no question". I don't think you're being fair when you call them narrow.
I have been saying that they *do* preclude God. They rule him out.

"Naturalism" as you define it, has nothing whatsoever to do with science. The vast majority of scientists are religious people who believe in a Creator. They just recognize what you often fail to - that the methods of science are only valid within nature. Nothing about any scientific theory precludes the involvement of God. It simply cannot and will not assume it.
So you think I fail to see that the methods of science are limited to nature? I don't think you have understood my position very much. Which is fine. You don't have to. But what both debating with me if you aren't going to at least try to understand me, sister? I don't think my position is really that hard to understand.

And incidentally, I have always said that science does not rule out God. Just goes to show that you are just saying your little piece irrespective of what I have been saying.

And then when someone responds to your accusations stating that science can only explore the natural, you accuse them of misunderstanding.

It is the very method of science that does not allow for God to be used in a scientific explanation. Unless, that is, you have a way to falsify God?
Dem, we have been through all this before. I agree with your first statement. And the answer to your question is 'no'.


Now, I think it's pretty clear that even you aren't clear on your own position. You openly suggest that anyone who does not include God is precluding them, then not, then are, then not, etc. And then when people point this out, they're confused. It would be amusing if you were joking.

Futhermore, it cannot be selected, since 'selected' implies a deliberate action. If we are talking about abiogenesis, this is not an option.

Right out of the Creationist Handbook for Rejecting Science (tm).
For example, if there is an assumption within evolutionary theory that cannot be tested, for example, the assumption that homology equals common ancestry, and the natural conclusion that humans evolved from apes, then this assumption cannot be proven wrong through science. In this way, much of the explanations one hears in evolutionary theory simply cannot be proven wrong. It is on equal footing with belief in the smurfs or fairys or God when it cannot be proven wrong.

Right out of the Creationist Handbook for Rejecting Science (tm).

Then perhaps you can agree that science cannot prove that we evolved from apes or monkeys. Then why do you accept it?

Right out of the Creationist Handbook for Rejecting Science (tm).

But I do not see how evolutionary theory has directly helped modern medicine.

HA. That's the best one. For a guy who claims to work with bacteria, that's pretty good.

For example, I do not believe that todays bacteria evolved from a common ancestor, because I believe that God created bacteria. I am not going to publish my belief in a paper, but I am also not going to search for an evolutionary tree for the different families of soil bacteria. I think this is perhaps where we are at odds.

An admission that you do not explore certain ideas because they disagree with your conclusion. Science is on a constant quest to disprove what it holds to be true or in not doing so despite the most vigorous of efforts, support current theory. By refusing to attempt to disprove your beliefs you refuse to do science. This is why you are accused of being no scientist repeatedly and why I find your claims to the contrary to be specious. I find it hard to believe you can have the knowledge you claim to have of bacteria and genetics and no so little about evolutionary theory and its fruit.

Dem, I hope this helps. He seems to like contradicting himself and then blaming you for listening to what he says and responding to it. I've seen him in several threads accuse you of not being capable of following along.

Exactly my point! It doesn't become information until something begins to use it. Which means that the exact same complexity could not be information now, but could be information tomorrow.


Oh, I see your point now. But doesn't solve the initial problem of the lack of life that can recognise complexity as information.


I didn't design the information. It was already there. The computer program is simply an example of something that could "read" the information. Another example would be certain enzymes....


You designed the computer program. To be more realistic, you would have to wait for random forces to supply a computer program with which you could use to read the existing complexity.


It isn't information at first. It becomes information once something can "read" it. A bunch of random zeroes and ones means nothing to me, but a computer can "read" it, so it is information to the computer. To me, it looks purely random.


Once something can recognise it......just how are you to go about getting that something to recognise it? And then you have to hope that that something knows how to ''read'' it, and then you have to hope that that something knows how to do something with the message that it has just understood for the first time. The problem isn't providing complexity, the problem has always been one of interpreting the complexity to mean something, i.e. information.


But it can be meaningless and then gain meaning when something attaches meaning to it.


Only if the entity doing the attachment of meaning is, 1) available, 2) capable of reading, 3) able to do something with the message, and 4) that action leads to an increased ability to survive and replicate. If any one of these factors is missing, the complexity will either remain meaningless, or at least be incapable of contributing to life.


Like I said, you wouldn't have that something at first - not at the time of abiogenesis. However, once life had arisen, controls would begin to arise as well, through natural selection, because spontaneous polymerization would no longer be beneficial...


That means you are moving away from abiogenesis and into evolutionary theory. Once you overcome the hurdle of actually having life present, then you have to think about how life can cope with the changes that it needs to make in order to explain more complex life forms. It's not enough to speculate that 'controls may have arisen'. But you also have to think about how those controls would have impacted the life form. Many of these controls are quite complex, and if incomplete, result in the death of a cell, or inability to replicate, rather than a benefit.

Furthermore, the conditions under which we have seen spontaneous polymerisation are not those that support life, so the DNA polymerase (or RNA polymerase, more likely) would have to have been present before life began. Perhaps the RNA itself served as a catalyst. But what is there to stop the catalyst from killing any chances the cell might have, say, by catalysing useless polymerisation? How can you develop control of a catalyst before you have life?


Do you think that RNAses came about before or after RNA?

Meanwhile, even without RNAses, RNA is unstable - precisely why it is more likely as a conduit for the very beginning of life.


If I was commited to evolutionary theory, I would say that the RNA would have to come before the RNases, since RNaes are proteins.

I don't think RNA is any less stable than DNA, or at least not very much. It seems to work well in a PCR reaction that requires temperatures up to 100 degrees celcius, not to mention all those RNA microarray analyses. It is certainly more stable than proteins. And an unstable molecule would be quite unsuitable for life, because it would need to have a half life that lasts through cell division--unlikely to be a rapid process in primitive life.


Exactly my point. That's why we were talking about self-replication, and not enzyme-mediated replication.


But self-replication fails utterly as a sufficient method of providing the same sequence more than once. The connection between the nucleotides is a phosphate, and has nothing to do with the sugar base. In other words, there is nothing on a nucleotide that could influence sequence specificity in spontaneous polymerisation.


...which is why life would not have arisen from codes that didn't include these things.


That's incredible. Are you suggesting that information capable of coding for cell walls was possible from spontaneous polymerisation?


Hmmm, so you admit you were wrong when you said that evolutionary theory goes against the predictions of the SLT2?


No, not necessarily. The SLT does not say anything about the abiogenesis issue, and rightly so. But when we understand the SLT, we would not predict that abiogenesis was likely. In that sense, evolutionary theory does go against the SLT. Or to put it another way, the implications of the SLT does not favour abiogenesis, but it certainly cannot rule it out as an impossibility.


Wrong. There are no deviations from the law that we have ever observed. The fact that non-spontaneous reactions occur in the body is not a deviation from SLT2, because we can see where the extra energy that causes those reactions (usually another coupled reaction) is coming from. The overall system never deviates from the law, or we would have to declare the law wrong.


I simply meant that if not for other factors at work in our bodies, such as the life force, and the information encoded there, the forces described by the SLT would have killed us. So while it isn't the forces of nature that are broken, but it is the general description of the original implications of the SLT that are overrided by stronger forces. It's like saying that the force of gravity means that we humans are earthbound, but when we change the parameters, we can actually harness the force of gravity and other forces (e.g. momentum, inertia of gas which pushes the wings up, etc.) to fly our airplanes at great speeds. The properties of momentum, etc. can be manipulated to overcome the original implications of gravity, but it never actually breaks the law of gravity. I had assumed you would have understood that point when I mentioned deviations from the SLT. I meant deviations from the original implications of the SLT, not deviations in the force that the law describes.


The idea makes sense, but there has not been enough data gathered to say it is supported as a theory.


Perhaps we ought to face the possibility that there will never be enough data gathered to support abiogenesis, and that this is because it is impossible. The lack of data certainly isn't for the lack of looking for it.


Any other mechanism. I haven't seen any evidence that another mechanism must be defined, so I can't tell you what it might be. But if such evidence were to be found...


Anyway, it is possible that we might discover another major mechanism that can neatly explain all the holes in evolutionary theory, but I, for one, have no wish to sit on my hands waiting. I actually think we shouldn't be waiting. May as well wait for God to turn up.


You have stated that you don't think they should be numerous times.


Perhaps you could show me where I have said that science methods should not be limited to nature? And if I have (perhaps I did a long time ago, like last year when I first joined NS, I don't recall), then at least I don't think that now, and have not been saying this on this thread. You seem to be arguing against what you think I was saying over a year ago.


No, you haven't. You have consistently stated that modern science completely rules out God by not including God. Why do you insist on flat-out lying?


I think I meant that there is a component within the modern science community (called naturalism) which rules out the possibility of God, and it is this component that I am at odds with. Thus, I have always maintained that science itself (the empirical methodology) does not rule out God. Why do you accuse me of lying? Isn't that completely unnecessary?


One is derived from the methods of science. The other is derived through some other method.


OK. But the concept of naturalism is not derived from the methods of science. Anyone can see that science is limited to the natural world, but that does not mean we should believe that there is only the natural world. So why should we be expected to do our science as if the natural world were the only existing one?


And I'm sure such people have a problem with those who suggest that the beauty of the Earth is evidence for God. But since neither position is a scientific one, what does it matter in a discussion of science?


If there is an evidence for God in nature, it would be what the IDers are trying to do--uncover data in nature than can only be consistent with a designer and is not reconcilable with modern evolutionary theory. I'm not an IDer, since I do not take this approach, though I do find it rather interesting. Risky, sure, but interesting all the same.


Yes, and when we went through it before, you argued with that statement - quite vehemently, in fact.

I don't believe you.



In his lectures mostly - which is why I said you should talk to him.

Oh, how disappointing. But it sounds like he is/was one of your lecturers.


Here is a list of his research interests, from http://www.cds.caltech.edu/~doyle/home.htm

''Research Interests: Integrating modeling, ID, analysis and design of uncertain nonlinear systems, with applications throughout the aerospace and process control industries. Applications interests are motivated by the interplay between control, dynamical systems, and design and analysis of large, complex engineering systems. Computation in analysis and simulation, including complexity theory to guide algorithm development. ''

The second item in the lists of interests is ID. Is that intelligent design, or something else, would you say?

If priests and nuns are in any way related to the people in their community, the genes "benefit" from them helping to keep others alive.


So will you admit that whenever the priests and nuns are not related to the people in their community, e.g. Mother Teresa, then the evolutionary theory falls down?


In some cases. In others, they are getting larger. In some organisms, the entire genome is copied more than once.

You ought to provide some support for that.


In some, there seems to be an entirely unknown mechanism for saving information from two generations ago.


How is that relevant?


And can you not imagine a case in which the selective pressure is never removed? Or the mutations that would remove the excess gene never occur, instead leading to that gene mutating into something else?


Yes, I can imagine it, but is it likely, and do we have an example of this?


Your problem is that you want a theory to empirically demonstrate an example of every possibility within it, but that is not necessary for something to be a valid theory.

Not of every possibility, just the main ones on which the whole theory hangs. They ought to be necessary, wouldn't you say?

Oh, I see your point now. But doesn't solve the initial problem of the lack of life that can recognise complexity as information.

It isn't life that recognizes complexity as information - not always anyways.

You designed the computer program. To be more realistic, you would have to wait for random forces to supply a computer program with which you could use to read the existing complexity.

And that is where the analogy breaks down. But the point I was making was that any complexity can become information, if some entity uses it as such. Thus, "information" can arise from complexity, and we know that complexity can arise from randomness.

Once something can recognise it......just how are you to go about getting that something to recognise it?

Good question - and exactly the question that abiogenesis would have to answer - with empirical evidence - to become a theory.

And then you have to hope that that something knows how to ''read'' it, and then you have to hope that that something knows how to do something with the message that it has just understood for the first time.

You don't have to "hope" anything. If such a thing were to develop, it would have developed. You seem to be assuming that abiogenesis, if it occurred, must be a directed process - that it must be "trying" to form life, as it were. This is the same common mistake people make when questioning why other creatures haven't evolved in certain ways that they think make more sense. The answer is simple: "It didn't happen that way."

Only if the entity doing the attachment of meaning is, 1) available, 2) capable of reading, 3) able to do something with the message, and 4) that action leads to an increased ability to survive and replicate. If any one of these factors is missing, the complexity will either remain meaningless, or at least be incapable of contributing to life.

Indeed.

That means you are moving away from abiogenesis and into evolutionary theory. Once you overcome the hurdle of actually having life present, then you have to think about how life can cope with the changes that it needs to make in order to explain more complex life forms. It's not enough to speculate that 'controls may have arisen'. But you also have to think about how those controls would have impacted the life form. Many of these controls are quite complex, and if incomplete, result in the death of a cell, or inability to replicate, rather than a benefit.

Ah, the common ID fallacy. You are trying to use the way things are now to say what they would have done in more primitive forms. This is basically the "irreducible complexity" argument, and it simply doesn't work. Yes, removing part of the current system can lead to problems and death, but that does not demonstrate that all of those things are absolutely necessary to complete the process. It simply means they are necessary within the current system.

Furthermore, the conditions under which we have seen spontaneous polymerisation are not those that support life,

Oh?

Perhaps the RNA itself served as a catalyst. But what is there to stop the catalyst from killing any chances the cell might have, say, by catalysing useless polymerisation?

Nothing stops that - and it was most likely a much more common case than the case in which cells would actually form life. Hence the need for lots and lots of tries.

If I was commited to evolutionary theory, I would say that the RNA would have to come before the RNases, since RNaes are proteins.

Are you under the impression that all proteins necessarily came after nucleic acids?

I don't think RNA is any less stable than DNA, or at least not very much.

What did you say your field was again?

Because of the hydroxyl group on RNA, it is much more unstable than DNA. This is basic biochemistry here. Meanwhile, if RNA were not a great deal less stable than DNA, we would have a major problem with turning signals on and off in cells.

It seems to work well in a PCR reaction that requires temperatures up to 100 degrees celcius,

PCR generally involves DNA, not RNA.

It is certainly more stable than proteins.

If this were true, cells would tend to have RNA sticking around longer than proteins, don't you think? And yet, this is not the case.....

And an unstable molecule would be quite unsuitable for life, because it would need to have a half life that lasts through cell division--unlikely to be a rapid process in primitive life.

Actually, it would be likely to be much more rapid in primitive life, without all the fun checks and such inherent in more developed cells.

And keep in mind that, despite its lack of stability, RNA is the carrier for more than one virus. There certainly are ways of keeping it around, but the fact that it is less stable than DNA is clear.

But self-replication fails utterly as a sufficient method of providing the same sequence more than once. The connection between the nucleotides is a phosphate, and has nothing to do with the sugar base. In other words, there is nothing on a nucleotide that could influence sequence specificity in spontaneous polymerisation.

Except, of course, the fact that sugar bases recognize one another. Self-replication would involve a mirror copy intermediate, but could occur nonetheless.

That's incredible. Are you suggesting that information capable of coding for cell walls was possible from spontaneous polymerisation?

No. By the time it got to cell walls, you are probably looking at mutations of an existing code.

No, not necessarily.

Then you are clearly contradicting yourself.

The SLT does not say anything about the abiogenesis issue, and rightly so. But when we understand the SLT, we would not predict that abiogenesis was likely.

Actually, if we understand the SLT, we would not predict that it was unlikely. We would know that, with the necessary arrangement of energy, it might actually be the most likely thing to happen.

I simply meant that if not for other factors at work in our bodies, such as the life force, and the information encoded there, the forces described by the SLT would have killed us.

But what you fail to recognize is that all of those things, the "life force" (whatever you mean by that), DNA, etc. are all governed by the SLT2, same as everything else we have observed. They aren't working "against" it - they are working within it.

It's like saying that the force of gravity means that we humans are earthbound, but when we change the parameters, we can actually harness the force of gravity and other forces (e.g. momentum, inertia of gas which pushes the wings up, etc.) to fly our airplanes at great speeds. The properties of momentum, etc. can be manipulated to overcome the original implications of gravity, but it never actually breaks the law of gravity. I had assumed you would have understood that point when I mentioned deviations from the SLT. I meant deviations from the original implications of the SLT, not deviations in the force that the law describes.

So, by "original implications", you mean "misunderstandings"?

Perhaps we ought to face the possibility that there will never be enough data gathered to support abiogenesis, and that this is because it is impossible. The lack of data certainly isn't for the lack of looking for it.

That is certainly a possibility.

Anyway, it is possible that we might discover another major mechanism that can neatly explain all the holes in evolutionary theory, but I, for one, have no wish to sit on my hands waiting. I actually think we shouldn't be waiting. May as well wait for God to turn up.

If you think there is another mechanism, perhaps you should try to find it. No one is suggesting that you sit around.

Perhaps you could show me where I have said that science methods should not be limited to nature?

Every single thread in which I have ever interacted with you.

I think I meant that there is a component within the modern science community (called naturalism) which rules out the possibility of God, and it is this component that I am at odds with.

There is no element within the science community that does so, however. There are human beings that rule out that possibility in their personal beliefs - we call them atheists. But there is no one who does so in their capacity as a scientist, because it is just as impossible as using science to prove that God exists.

Thus, I have always maintained that science itself (the empirical methodology) does not rule out God.

Actually, you have argued repeatedly and vehemently that the fact that science does not mention God means that all of science disallows God. You have done so in every thread in which I have ever discussed this with you.

Thus, you have not "always maintained" any such thing. If you maintain that now, it is a good change, but at least admit that it is a change. The whole, "I changed my mind, but I really believed it the whole time," simply doesn't work.

Why do you accuse me of lying?

Because you are lying. You are claiming to have "always maintained" the exact opposite of what you have always argued with me.

OK. But the concept of naturalism is not derived from the methods of science. Anyone can see that science is limited to the natural world, but that does not mean we should believe that there is only the natural world. So why should we be expected to do our science as if the natural world were the only existing one?

If science is limited to the natural world, then the only way to possibly do science is to do it as if the natural world were the only existing one. Outside of science, you may believe that the natural world is all that exists, but within it, the natural world is all that can be observed.

If there is an evidence for God in nature, it would be what the IDers are trying to do--uncover data in nature than can only be consistent with a designer and is not reconcilable with modern evolutionary theory. I'm not an IDer, since I do not take this approach, though I do find it rather interesting. Risky, sure, but interesting all the same.

It is completely unscientific, however. You cannot possibly find data that "can only be consistent with...." using the scientific method. Meanwhile, the only way to even suggest that your data could only be consistent with a designer is to assume that a designer exists - and unfalsifiable claim.

I don't believe you.

Riiiiiight.

Oh, how disappointing. But it sounds like he is/was one of your lecturers.

He's actually my advisor's husband. I've seen him lecture several times.

Here is a list of his research interests, from http://www.cds.caltech.edu/~doyle/home.htm

''Research Interests: Integrating modeling, ID, analysis and design of uncertain nonlinear systems, with applications throughout the aerospace and process control industries. Applications interests are motivated by the interplay between control, dynamical systems, and design and analysis of large, complex engineering systems. Computation in analysis and simulation, including complexity theory to guide algorithm development. ''

The second item in the lists of interests is ID. Is that intelligent design, or something else, would you say?

I can guarrantee that it isn't Intelligent Design. John is pretty scathing in his condemnation of the entire idea.

So will you admit that whenever the priests and nuns are not related to the people in their community, e.g. Mother Teresa, then the evolutionary theory falls down?

No. It just means that they made a choice that was detrimental to their reproductive success, and thus didn't pass on their genes. As such, evolutionary theory would suggest that, well, they wouldn't pass on their genes.

You ought to provide some support for that.

It was already provided earlier in the thread, but I'll look around when I get a chance.

How is that relevant?

Such information has to be stored and passed on somehow - and would be entirely spurious in most cases. This process would take much more energy than a single extra gene in the code, and yet it has been developed.

Yes, I can imagine it, but is it likely, and do we have an example of this?

I see no reason that it is any less likely than a selective pressure that isn't removed. In fact, in nature, I would expect that the selective pressure usually isn't removed, at least not in a short time-span. If the temperature begins to get warmer in a given ecosystem, for instance, you would expect to see that stick around for a while.

Not of every possibility, just the main ones on which the whole theory hangs. They ought to be necessary, wouldn't you say?

The whole theory hangs upon the possibility of mutations occuring, and natural selection working. We have plenty of evidence for these things.

Or maybe you were trying to say it's right, but it's based on an unsupported assumption. Now, the second idea wouldn't make any sense, but neither does claiming something is baded on an unsupported assumption and then claiming you're not rejecting it.

Why doesn't that make sense?


Keep in mind we are talking about evolution and you have clearly stated you think it is a naturalist theory even though the majority of people who hold it are Christian and the it has never been successfully debunked.


But I have said that God is capable of using evolution, so evolution doesn't need to be a naturalist theory. I think evolution is certainly influenced by naturalism, and yes, I would say that the majority of scientists are influenced by naturalism.



If one reads the theory and notices that it doesn't mention ANYTHING about God, whatsoever, they must simply not be well-read enough to understand you're unique understanding that the vast, vast majority of mainstream science that accepts evolution are confused by naturalism.


Perhaps they are confused. And of course, being in the majority does not make one right.


In the end you admit, the absense of God is your complaint.

No, the absence of God in a paper is not my complaint.


Yet, you later try to pretend that they are actually denying God rather than simply leaving them out.

No, not necessarily.


Yet, even later, when accused of allowing your personal beliefs to color your science you say that you practice science without addressing the fact that you cannot explore the supernatural with it, yet you aren't a naturalist (like you accuse others of being).

I do address the fact that I cannot explore God with science. The very thought is preposterous. And no, it is not naturalist to recognise the limitations of science.



And then when someone responds to your accusations stating that science can only explore the natural, you accuse them of misunderstanding.


Rubbish.



Now, I think it's pretty clear that even you aren't clear on your own position. You openly suggest that anyone who does not include God is precluding them, then not, then are, then not, etc. And then when people point this out, they're confused. It would be amusing if you were joking.


Ok, lets get to a little more detail on this one. Dem was saying that a scientific theory cannot include the supernatural, at least that is what I think she was saying. I agree that science does not test for the supernatural, cannot measure it, cannot falsify it, and thus should not include the supernatural within the theory. However, as has been my position all along, that does not mean that we cannot allow the idea that God created. (In my work, for example, it doesn't really matter whether bacteria evolved or created, so neither idea impacts my work.) Just as the naturalistic concept of everything being explainable by natural forces should not be a part of scientific theory, since it cannot be tested or falsified, so also should we avoid including the supernatural in theories that we hope to test.




Right out of the Creationist Handbook for Rejecting Science (tm).


Isn't that irrelevant? There could be all sorts of reasons for the similarity, only one of which includes the possibility that I have been reading creationist literature. (I can tell you that I have been reading their literature.) Other possibilities could be that anyone capable of reason would reach the same conclusions, so long as they consider creation a possibility.


HA. That's the best one. For a guy who claims to work with bacteria, that's pretty good.


Progress in modern medicine is simply not based on evolutionary theory. It is based on understanding natural selection and variability through random mutations, among other things, but not the concept that we are all genetically related to bacteria.


An admission that you do not explore certain ideas because they disagree with your conclusion. Science is on a constant quest to disprove what it holds to be true or in not doing so despite the most vigorous of efforts, support current theory. By refusing to attempt to disprove your beliefs you refuse to do science.

Actually, considering our limited resources, I would say that scientists do this all the time. And science is a good deal more than simply trying to disprove what it holds to be true. If you really think that, you have a very limited understanding of science.

No. It just means that they made a choice that was detrimental to their reproductive success, and thus didn't pass on their genes. As such, evolutionary theory would suggest that, well, they wouldn't pass on their genes.

So in that case, we have a situation that is inconsistent with evolutionary predictions.



Such information has to be stored and passed on somehow - and would be entirely spurious in most cases. This process would take much more energy than a single extra gene in the code, and yet it has been developed.


Thus making abiogenesis seem even less likely.


I see no reason that it is any less likely than a selective pressure that isn't removed. In fact, in nature, I would expect that the selective pressure usually isn't removed, at least not in a short time-span. If the temperature begins to get warmer in a given ecosystem, for instance, you would expect to see that stick around for a while.


How long do you think is the half life of an antibiotic? And do you think such a pressure explains all the genome expansion necessary to explain evolution?


The whole theory hangs upon the possibility of mutations occuring, and natural selection working. We have plenty of evidence for these things.

And when these processes result in the opposite effect that we expect from evolutionary theory, we might be forgiven for being skeptical of the idea that mutation and natural selection result in evolution.

So in that case, we have a situation that is inconsistent with evolutionary predictions.

Where exactly in evolutionary theory does it suggest that every creature will reproduce and pass on its genes?

Thus making abiogenesis seem even less likely.

How so?

How long do you think is the half life of an antibiotic?

Much shorter than that of large-scale changes in an ecosystem.

And do you think such a pressure explains all the genome expansion necessary to explain evolution?

It certainly can. And I've seen no evidence to suggest that it cannot.

And when these processes result in the opposite effect that we expect from evolutionary theory, we might be forgiven for being skeptical of the idea that mutation and natural selection result in evolution.

What processes are the opposite that we would expect from evolutionary theory?

It isn't life that recognizes complexity as information - not always anyways.

I agree, but how is that relevant?


And that is where the analogy breaks down. But the point I was making was that any complexity can become information, if some entity uses it as such. Thus, "information" can arise from complexity, and we know that complexity can arise from randomness.

I can see your point. And I say that it is theoretically possible (I have always maintained that abiogenesis cannot be impossible). And yet practically, I don't think think this is very likely. Do you?


You don't have to "hope" anything. If such a thing were to develop, it would have developed. You seem to be assuming that abiogenesis, if it occurred, must be a directed process - that it must be "trying" to form life, as it were. This is the same common mistake people make when questioning why other creatures haven't evolved in certain ways that they think make more sense. The answer is simple: "It didn't happen that way."


I have in mind the basic requirements of life, such as the cell wall, genetic material, energy source, etc. These requirements serve as goals in the development of life, since if they are not reached, life is not possible (as far as we currently understand life). It's not that I think life is 'trying', but in considering the possibility of abiogenesis, isn't it logical to keep in mind what we know of the progress that seems necessary for the possibility of life?



Ah, the common ID fallacy. You are trying to use the way things are now to say what they would have done in more primitive forms. This is basically the "irreducible complexity" argument, and it simply doesn't work. Yes, removing part of the current system can lead to problems and death, but that does not demonstrate that all of those things are absolutely necessary to complete the process. It simply means they are necessary within the current system.


I was referring to the necessary complexity for life, even the most primitive form concievable, based on what we currently know of biochemistry, not only the current system.


Nothing stops that - and it was most likely a much more common case than the case in which cells would actually form life. Hence the need for lots and lots of tries.


Ah, the common evolution fallacy--lots of tries will solve any problem. That might be the case if the system wasn't dependent on a number of critical steps all of which will only work given an almost infinite number of tries, but have a very limited timespan, i.e. how long must a cell wait before it can develop the right genes to replicate?. But in the case of abiogenesis, having lots of tries actually present more problems, making time an even more critical factor.


Are you under the impression that all proteins necessarily came after nucleic acids?


It certainly seems that way in current life forms. Do you know of an alternative?


What did you say your field was again?

Because of the hydroxyl group on RNA, it is much more unstable than DNA. This is basic biochemistry here. Meanwhile, if RNA were not a great deal less stable than DNA, we would have a major problem with turning signals on and off in cells.


But the instability of RNA in life forms is not due to the hydroxyl group, but to the abundance of RNases.


PCR generally involves DNA, not RNA.


Ever heard of real time reverse transcriptase PCR?


If this were true, cells would tend to have RNA sticking around longer than proteins, don't you think? And yet, this is not the case.....


That's probably because of the abundance of RNases, and the greater stability of RNases compared to proteases, rather than the chemical stability of proteins. For example, most proteins would not survive a PCR reaction, while the RNA can. The simple reason is that RNA can reanneal after denaturation, while most proteins do not, after denaturation.


Actually, it would be likely to be much more rapid in primitive life, without all the fun checks and such inherent in more developed cells.


The checks make life possible. They ensure one of the most basic requirements, like control of cell division and control of energy.


Except, of course, the fact that sugar bases recognize one another. Self-replication would involve a mirror copy intermediate, but could occur nonetheless.


Polymerisation occurs for single strands. Only later do the single strands anneal, at which point the 'recognition' of the sugar bases becomes important. I.e. recognition between bases is a factor in annealing, not polymerisation.


No. By the time it got to cell walls, you are probably looking at mutations of an existing code.


Life is not possible without cell walls, for it forms the basis of energy control.


Then you are clearly contradicting yourself.


Why?


Actually, if we understand the SLT, we would not predict that it was unlikely. We would know that, with the necessary arrangement of energy, it might actually be the most likely thing to happen.


That would mean that our understanding of the SLT would have to be drastically changed. I can't see that happening, but I suppose it is possible.


But what you fail to recognize is that all of those things, the "life force" (whatever you mean by that), DNA, etc. are all governed by the SLT2, same as everything else we have observed. They aren't working "against" it - they are working within it.


It is possible to have a dead body full of living cells. The life force, whatever it is, is more than the mere sum of living tissue. And yet without this life, all the cells will eventually die. We are not in a position to define what this life is, other than describe it as having some sort of electricity (although no one really thinks that electricity is life). I don't see SLT as the governing law of nature in life forms, but one of many. Life consists of all the laws of nature working together, plus something else (i.e a life force). It is this something else that is the difference between a dead body and a living one, since both of them obey the SLT but have very different properties. Thus, one can say that the SLT is not the dominating force, because of the presence of the life force.


So, by "original implications", you mean "misunderstandings"?


I mean that which would happen were the life force absent.


If you think there is another mechanism, perhaps you should try to find it. No one is suggesting that you sit around.



I think there is a lot that is left to be discovered about the natural world. I am happy to focus on what I have already began.


Every single thread in which I have ever interacted with you.


Even this one?


There is no element within the science community that does so, however. There are human beings that rule out that possibility in their personal beliefs - we call them atheists. But there is no one who does so in their capacity as a scientist, because it is just as impossible as using science to prove that God exists.


I agree that they don't do this in their capacity as scientists, but there are plenty who would argue this from their position/status as scientists.


Actually, you have argued repeatedly and vehemently that the fact that science does not mention God means that all of science disallows God. You have done so in every thread in which I have ever discussed this with you.


Rubbish. And I think you know that is rubbish. I do not agree that the lack of mention of God in a paper means the disallowing of the existence of God. I have said so clearly to you on several occassions.



Because you are lying. You are claiming to have "always maintained" the exact opposite of what you have always argued with me.


But the actual charge of lying is not necessarily true. The other possibilities include your being mistaken/confused about what I have said, and my being mistaken/confused about what I have said. Either of these cases are more likely than my lying, since I believe that lying is a sin, and I can tell you plainly that I am not lying, and do not wish to. What would I gain from lying anyway. To win a debate? Pffff. Hardly. Not on NS. I'm hear to learn, not to win. And I'll go when I think I have learned enough, or when I am too tired to learn any more, regardless of whether I have successfully defended my position or not.
In fact, I think your accusation of my dishonesty is simply unnecessary and even downright rude. You ought to avoid stooping to gutter tactics. Are you trying to win a debate?


If science is limited to the natural world, then the only way to possibly do science is to do it as if the natural world were the only existing one. Outside of science, you may believe that the natural world is all that exists, but within it, the natural world is all that can be observed.


I disagree. I don't do my science this way. It's unnecessary.


It is completely unscientific, however. You cannot possibly find data that "can only be consistent with...." using the scientific method.

Why not?


Meanwhile, the only way to even suggest that your data could only be consistent with a designer is to assume that a designer exists - and unfalsifiable claim.

The designer need not exist outside of the natural world, for the purposes of the experiment, thus the possibility of design can actually be tested.


He's actually my advisor's husband. I've seen him lecture several times.


OK. Impressive. But what is an advisor? Do you mean supervisor?


I can guarrantee that it isn't Intelligent Design. John is pretty scathing in his condemnation of the entire idea.

Fair enough. I wonder what it stands for. The site doesn't seem to explain what it means by 'ID', unless one of his main interests is trying to debunk it.

Where exactly in evolutionary theory does it suggest that every creature will reproduce and pass on its genes?


It doesn't, but it does say that every organism will at least try to pass on its genes. Humans are clearly the exception, it seems.


How so?


You said most of the genes would be spurious, and not helpful for the emergence of life. Given that the polymerisation of each of these genes costs energy, the chance of life emerging within an accidental, chemically derived (as opposed to genetically encoded) cell which had more spurious sequences of e.g. RNA than helpful ones is fairly slim, wouldn't you say?




It certainly can. And I've seen no evidence to suggest that it cannot.


In that scenario, genome growth would occur through the aquiring of antibiotic resistance genes, a preposterous idea and flatly contradicts the popular idea of homology found between genes of similar functions in a wide variets of organisms. Not only that, but there are many cases of antibiotic resistance that come about through a loss of a gene, rather than a gain.


What processes are the opposite that we would expect from evolutionary theory?


The general shrinking of genomes, for example. Or where speciation can be attribute in to a loss of information, rather than a gain in information.

Take it from a physics student:

entropy is not a measure of heat distibution. If heat becomes more evenly spread (for example ice melting) entropy increases, if heat becomes less evenly spread (for example, your nice frosty beer in the fridge) entropy still increases. entropy is (very basically put) a measure of how much change of temperature there has been, entropy can NEVER decrease only increase because you can't undo a change in heat (Unless the processes is totally reversable(which is not practically possible day to day))


confuse you?
it should cos it confuses the fuck outta me and I've got an exam on all that next week =)

You're right, but you're making it more confusing than it really is. Yes, no matter what happens, the global net change in entropy is positive. This means that in the context of the entire closed system, entropy grows no matter what you do or what happens. But in the case of the frosty beer for example, the entropy of the beer actually decreases. Why? Because the beer is not a closed system. The larger system - the kitchen, for example - suffers a net increase in entropy because the fridge must generate more waste heat to keep that beer cool. But the beer itself has a net decrease in entropy. The bottom line is that the mandatory net increase in entropy only has meaning for the closed global system, not for a particular object or subsystem.

Where exactly in evolutionary theory does it suggest that every creature will reproduce and pass on its genes?

Lol, is that what Bruarong is trying to argue? That genetic isolation of individuals by incapability of breeding is a contradiction in or violation of evolutionary theory?

It shouldn't really surprise me. All of his arguments - all of those that actually are arguments, and not just smoke and subjectivism - seem to revolve around deliberate misunderstandings.

I actually never said that scientists who rule out creation are narrow minded. Yet another example of your putting words in my mouth. I said that they considered one less option than I did, and that would make their views more narrow than mine.


and

I have not been saying that there is no natural explanation. I have said that I can see the difference between the comfort that comes from belief, and the comfort that comes from God. Sure, God uses natural forces, but not only natural ones.

So, you both agree that natural forces were used.

Then, you insist that supernatural forces were used, the others don't axiomatically accept that.

And you say THEY are being narrow.

Bruaraong, you talk about having "one more option", but you don't regard the supernatural as an option, you keep stating it as a fact. To include it categorically is just as narrow as excluding it out of hand.

So, if it is narrow to not assume God's supernatural creation, is it more narrow to not also include the efforts and contribution of Shiva, Brahma, and Vishnu?

Or is it only narrow to not assume and insist on supernatural effects inconsistent with your doctrine?

I can see your point. And I say that it is theoretically possible (I have always maintained that abiogenesis cannot be impossible). And yet practically, I don't think think this is very likely. Do you?

I think it is likely that life arose on the planet somehow - as evidenced by the fact that we are here. I think it is likely that we will eventually be able to describe the process by which it occurred. Are the current hypotheses correct? I don't know, but I see nothing as of yet to disprove them.

I have in mind the basic requirements of life, such as the cell wall,

The vast majority of life has no cell wall. You generally only see it in certain bacteria and in plants.

I was referring to the necessary complexity for life, even the most primitive form concievable, based on what we currently know of biochemistry, not only the current system.

If you weren't referring to the current system, then you wouldn't have referred to the fact that removing a given "cog" from the current system causes problems.

Ah, the common evolution fallacy--lots of tries will solve any problem.

I didn't claim that. Try again.

It certainly seems that way in current life forms. Do you know of an alternative?

Are you under the impression that nucleic acids and proteins only exist within lifeforms?

But the instability of RNA in life forms is not due to the hydroxyl group, but to the abundance of RNases.

RNAses don't cause instability - they actively attack the RNA molecule. And its short life-span in life is mostly due to RNAses. However, even in the absence of such enzymes, the life-span of an RNA molecule would be much shorter than that of a DNA molecule - because of the hydroxyl group.

Ever heard of real time reverse transcriptase PCR?

Yup, and the RNA is never taken up to temperatures of 100 C in that. The first step is the reverse transcriptase step - in which the RNA is copied to cDNA. The actual PCR reaction is run on the cDNA.

For example, most proteins would not survive a PCR reaction, while the RNA can. The simple reason is that RNA can reanneal after denaturation, while most proteins do not, after denaturation.

You are aware that most RNA in life is single-stranded, correct? In fact, double-stranded RNA is, to my knowledge, only present in viruses. Thus, there is no "reannealing" of RNA. It is DNA that reanneals during the PCR process.

The checks make life possible. They ensure one of the most basic requirements, like control of cell division and control of energy.

And yet life exists if cell division goes wonky. It is cancerous life, but life nonetheless.

Polymerisation occurs for single strands. Only later do the single strands anneal, at which point the 'recognition' of the sugar bases becomes important. I.e. recognition between bases is a factor in annealing, not polymerisation.

And the two can be concurrent. It is entirely possible for base pairs to line up, and for that reason polymerize.

Life is not possible without cell walls, for it forms the basis of energy control.

Methinks you are confusing cell walls with plasma membranes.

The plethora of incorrect biology in this post is beginning to suggest to me that you either completely made up your career in the field, or that you went to the worst school on the planet.

Why?

If evolutionary theory went against the predictions of the SLT2, then one of them would have to be wrong. You can't say, "This phenomenon goes against the predictions of this theory, but both of them might be right."

That would mean that our understanding of the SLT would have to be drastically changed. I can't see that happening, but I suppose it is possible.

No, it would mean that your misunderstanding of the SLT2 would have to be changed. Those of us who actually understand the thermodynamics behind it don't need a change in the rule to see it.

I mean that which would happen were the life force absent.

Then you are misusing the ideas.

Even this one?

No, in this one you are trying to argue that you have always argued the exact opposite of what you have always said.

Rubbish. And I think you know that is rubbish. I do not agree that the lack of mention of God in a paper means the disallowing of the existence of God. I have said so clearly to you on several occassions.

And you have also quite clearly stated that the lack of mentioning God is the disallowance of the existence or involvement of God. Which is what makes me wonder what exactly is going on in your head.

But the actual charge of lying is not necessarily true.

I suppose you could have forgotten every other thread in which we have had this discussion. I suppose you could have been saying one thing all along while meaning the exact opposite. But neither of these seems very likely.

I disagree. I don't do my science this way. It's unnecessary.

The only way to not do your science this way would be to inject something about the supernatural into science. And if you do that, it ceases to be science. If you do not bring the supernatural into science, then you are doing science as if the supernatural does not exist.

Why not?

Because everything, no matter how sure you are of it, is open to question in science. There is no data that can absolutely only be consistent with one explanation, because there is always the chance that data will come along to disprove that explanation. We can never say that we have disproven all other possibilities, because we don't even know what all the other possibilities might be.

The designer need not exist outside of the natural world, for the purposes of the experiment, thus the possibility of design can actually be tested.

Nearly every proponent of ID has admitted that their "intelligent designer" is "God".

OK. Impressive. But what is an advisor? Do you mean supervisor?

No, I mean advisor. I am currently working on my thesis and she is the principal investigator in the lab.

Fair enough. I wonder what it stands for. The site doesn't seem to explain what it means by 'ID', unless one of his main interests is trying to debunk it.

No, believe me when I say he doesn't give Intelligent Deisgn more than a passing glance. My best guesses would be "Industiral Design" or "Integrated Design" or something along those lines. I'm not completely familiar with his field, so I can't be sure.

It doesn't, but it does say that every organism will at least try to pass on its genes. Humans are clearly the exception, it seems.

Evolutionary theory doesn't claim that every organism will try and pass on its genes. In fact, it allows quite neatly for one that does not - such an organism will be selected out of existence.

You said most of the genes would be spurious, and not helpful for the emergence of life. Given that the polymerisation of each of these genes costs energy, the chance of life emerging within an accidental, chemically derived (as opposed to genetically encoded) cell which had more spurious sequences of e.g. RNA than helpful ones is fairly slim, wouldn't you say?

Very slim. But so are many things that happen in the world.

In that scenario, genome growth would occur through the aquiring of antibiotic resistance genes, a preposterous idea and flatly contradicts the popular idea of homology found between genes of similar functions in a wide variets of organisms. Not only that, but there are many cases of antibiotic resistance that come about through a loss of a gene, rather than a gain.

I was under the impression that we were talking about all mutations, not just those that confer antibiotic resistance.

The general shrinking of genomes, for example. Or where speciation can be attribute in to a loss of information, rather than a gain in information.

Evolutionary theory does not preclude the shrinking of genomes - something you have admitted yourself.

Nor does it in any way predict that speciation will not occur due to the loss of information.

Why do your arguments always boil down to a complete misunderstanding of the theory you are arguing on?

No, the absence of God in a paper is not my complaint.

Okay. You said it was. You said plainly they don't outright deny God, but simply leave him out of the places you think he belongs. Do I need to quote you again.

I do address the fact that I cannot explore God with science. The very thought is preposterous. And no, it is not naturalist to recognise the limitations of science.

Uh-huh. So you keep saying, yet you keep saying that you want science to stop looking for natural explanations and accept God did it. I quoted you saying it.

Ok, lets get to a little more detail on this one. Dem was saying that a scientific theory cannot include the supernatural, at least that is what I think she was saying. I agree that science does not test for the supernatural, cannot measure it, cannot falsify it, and thus should not include the supernatural within the theory. However, as has been my position all along, that does not mean that we cannot allow the idea that God created. (In my work, for example, it doesn't really matter whether bacteria evolved or created, so neither idea impacts my work.) Just as the naturalistic concept of everything being explainable by natural forces should not be a part of scientific theory, since it cannot be tested or falsified, so also should we avoid including the supernatural in theories that we hope to test.

Uh-huh. Yet, you complained that scientific papers leave out God. I believe your words were a "complete absense of God".

Let's quote it again -

If you read up enough of evolutionary theory, you might not find this spelled out directly, but you will see a complete absense of God, even when there is no sensible alternative.

Yes, how could anyone confuse that with you suggesting that God should appear in scientific papers. If only people could have better reading comprehension, huh? Maybe then they would stop responding to what you ACTUALLY POST.

Isn't that irrelevant? There could be all sorts of reasons for the similarity, only one of which includes the possibility that I have been reading creationist literature. (I can tell you that I have been reading their literature.) Other possibilities could be that anyone capable of reason would reach the same conclusions, so long as they consider creation a possibility.

Ha. Everyone capable of reason would think that selection implies a deliberate action in direct contention with the actual theories on selection, that man evolved from apes in direct contention with actual theories on the evolution of man, that evolutionary theory has no beneficial effect on medice in direct contention with the actual advances of medicine in the last several decades? Hmmmm... interesting argument. I guess I must not be capable of reason because I don't see the ape argument in the evolution of man and I actually choose to use the actual definition of selection used in theory rather than one I made up. I'm quirky like that.

Progress in modern medicine is simply not based on evolutionary theory. It is based on understanding natural selection and variability through random mutations, among other things, but not the concept that we are all genetically related to bacteria.

Ha. Are you arguing that natural selection and variablity have nothing to do with evolutionary theory? The evolution of man is a seperate theory and one you keep confusing with the theory of evolution and abiogenesis. Another reason one must question your claims of expertise.

Actually, considering our limited resources, I would say that scientists do this all the time. And science is a good deal more than simply trying to disprove what it holds to be true. If you really think that, you have a very limited understanding of science.
Are you actually claiming that it is acceptable in modern science to avoid disproving a theory simply because we believe it to be correct? I didn't say it was the only use of science, but simply that it is a main focus and a primary way science is conducted.

"Dr. Johnson, did you do any testing on whether your theory is false?"
"No, I believe it's true. Testing if there is a better theory or if my theory is flawed is a waste of time."
"Good job. You clearly are a stellar scientist. Here's the Nobel Prize for Science."

Lol, is that what Bruarong is trying to argue? That genetic isolation of individuals by incapability of breeding is a contradiction in or violation of evolutionary theory?

It shouldn't really surprise me. All of his arguments - all of those that actually are arguments, and not just smoke and subjectivism - seem to revolve around deliberate misunderstandings.

Unfortunately, yes. It appears that he intentionally misrepresents things and then when people correct him he acts as if he wasn't actually dismissing anything. It ceases to be amusing.

Unfortunately, yes. It appears that he intentionally misrepresents things and then when people correct him he acts as if he wasn't actually dismissing anything. It ceases to be amusing.

Well...I've noticed a theme in his argument that including additional aspects (as long as their his dogma) is somehow "less narrow"...

A: I believe God uses natural forces and not necessarily supernatural forces.

B: No, God uses natural and supernatural forces, necessarily. Stop being so narrow.

Oh, so you have heard about Richard Dawkins' idea of the selfish gene? That we shouldn't look at the effects of natural selection at the level of the individual, and it's effort to survive, but the level of the genes, and their 'need' to survive. I think he does have an interesting suggestion here, and it would appear to solve many problems--in the animal world at least. But human behaviour does not fit with this concept, since humans are capable of all sort of unselfish acts, many of which are directly against the interests of the genes, like priests and nuns, or those who risked everything to help the Jews during the holocaust. Even religion itself that points to a home in heaven is often resulting in actions that work against gene survival.I think what you're missing is that it's that it's a "Selfish Gene" idea, not a "Selfish Individual".

If a gene within a creature allows that creature to create 100% related offsprings (the drones, untainted by any 'father' DNA, and thus also 'birthable' without the need to attract/seek, vet and obtain the services of a male) that aid the survival of the self-same genes by serving that creature and the viably-reproductive offspring of that creature, then that gene has an advantage over the equivalent-but-different genetic sequence in a 'cousin' colony where no such mechanism occurs. Check out the details of "haplodiploidy" if you don't already know about it.

In many social animals (more regualrly social, even, never mind 'hive' societies) such as various prairie-based caninines, there exist 'breeding pairs' whose offspring are the genetic distilation of the succesful applicants to the positions, and aided by the non-reproductive 'aunts and uncles' of the new generation. Compared with packs where non-breeding members do not have the genetic imperative to assist (or may even be disruptive well beyond the normal competation to establish who are alphas-male/female) and there's an advantage.

Humanity has similar tendencies towards "supporting humanity". Some argue that a 'background' level of genetic tendency towards homo/asexuality is part of this "beneficial aunt or uncle" policy (two mothers are better than none, and spinster sisters have been invaluable assistants to those who become mothers in many societies) though there's a whole different kettle of fish in that argument.

To expand to the existence of 'unrelated' human assistants (priests, nuns, etc), it's just a matter of degrees. You may support your offspring. You may have no offspring but support your nieces and nephews. You may not have such close relatives but support your community. Your nation. Your race [edit: in hindesight, let's state that I mean colour, creed, other major population group with given shared characteristics]. You may support people who you believe need supporting (especially against people who you know are Doing Rather Too Well For Their Own Good, Thank You).

Indeed, it's hard to find any reason why there might be any reason to have genes (that express any relevant phenotype, mentality, tendancy) that are not totally sociably amenable, save that there is a balance point whereby a low inherant level of sociopathic behaviour can survive if society as a whole is not damaged so much that the few 'cheaters' that do exist make their own existence untenable. But I don't wish to take this discussion into Game Theory.


In short, individuals are individuals. Some individuals will be progenitors and some will not. To think otherwise would be like asking why we have elbows and knuckles and molars and spleens, because 'all' a body needs to are the respective gonads. (Yes, 'all' except the means for ensuring that said gonads, male and female, are housed within a suitably viable mechanism, to wit the human body, capable of consumption/processing of nutrients and of ensuring that the gametes within come in contact with the gametes of the complimentary pursuasion.)

I think what you're missing is that it's that it's a "Selfish Gene" idea, not a "Selfish Individual".And I forgot to say that humanity also has (not alone of all the creatures in the world, but certainly more identifiably advanced in ourselves) has developed beyond mere genetic continuation, and has developed a sufficient degree of information distribution that 'memetic continuation' is arguably a major constituent of a person's 'heritable legacy'.

This would explain couples (genetically childless through medical or personal[1] reasons) adopting Romanian orphans or the like. Genetically, they are supporting the continuation of the human species, rather than of their own particular stock. But they get the ability to convey their own ideals, religious beliefs, financial successes, language, identity to someone, leaving a legacy where otherwise there might be none. And if it 'feels good' doing to do it, it's all the same to the dopamine receptors.

But I'm far diverged from 2ndL/TD.

[1] Maybe because the maternal instincts (not developed in the light of modern society, and already susceptible to redirection into adoptive-behaviours in many maternal creatures encountering young not of their own/own species) can be assuaged without needing to undergo the biologically-risky process. Maybe due to the pressures of economics and the wish not to lose a dual-income. Maybe many reasons, a lot of which won't have existed while the proto-human mentaility was assessed against the pressures of the African Savannah and all other ancestral environments.

Be very careful on your test. Entropy is not a measure of heat, but of energy. Heat is a form of energy, and entropy often increases by heat dissipation, but that is certainly not the only way.


hense "very basically put" =)

but yes, I have a fair few reams of notes to look through before I'll be happy to walk into that exam next thursday =(

I think it is likely that life arose on the planet somehow - as evidenced by the fact that we are here. I think it is likely that we will eventually be able to describe the process by which it occurred. Are the current hypotheses correct? I don't know, but I see nothing as of yet to disprove them.

That is almost exactly the sort of problem I have with your thinking. e.g. abiogenesis must be true because life exists. Not that you said this clearly, but when someone does say it so clearly, it equals a deliberate disregard of the alternatives. It does not say that God did not create through special means (rather than through abiogenesis), but that is what it means.



The vast majority of life has no cell wall. You generally only see it in certain bacteria and in plants.


I was referring to the membrane barrier, rather than a strict cell wall. But anyway, in single celled animals, a cell wall is generally present, even in Gram negative bacteria with reduced petidoglycan (compared to Gram postitive). The point is, this cell envelope, be it a cell wall or a double membrane, or even a barrier like the mycoplasm, is necessary for life. I find it unlikely that polymerisation of RNA or DNA could adequately provide information to code for its production. Highly unlikely.


If you weren't referring to the current system, then you wouldn't have referred to the fact that removing a given "cog" from the current system causes problems.


No, I stated clearly that I was referring to the basic requirements for life, like a cell barrier and an energy system.


Are you under the impression that nucleic acids and proteins only exist within lifeforms?


Nucleic acids can form and polymerise under specific conditions (albeit unfriendly ones for life), producing short chains of nucleic acid, and while peptide bonds can temporarily form in abiotic conditions, proteins actually require either life or in vitro conditions in order to be synthesised.


RNAses don't cause instability - they actively attack the RNA molecule. And its short life-span in life is mostly due to RNAses. However, even in the absence of such enzymes, the life-span of an RNA molecule would be much shorter than that of a DNA molecule - because of the hydroxyl group.


What are you talking about? RNases are the cause of RNA instability, and the presence of the hydroxyl group is irrelevant by comparison.


Yup, and the RNA is never taken up to temperatures of 100 C in that. The first step is the reverse transcriptase step - in which the RNA is copied to cDNA. The actual PCR reaction is run on the cDNA.


When I perform RTPCRs, I always have a primary step which heats the RNA to 94 degrees C for a few minutes, before it is copied by the reverse transcriptase.


You are aware that most RNA in life is single-stranded, correct? In fact, double-stranded RNA is, to my knowledge, only present in viruses. Thus, there is no "reannealing" of RNA. It is DNA that reanneals during the PCR process.


But theoretically, if an RNA was ever supposed to catalyse a polymerisation of nucleic acid (e.g. in a primitive life form), it would have to return to a correctly folded state.


And yet life exists if cell division goes wonky. It is cancerous life, but life nonetheless.


The cancerous cell would be in a modern cell with all other controls in place, allowing growth. Instead, we were supposed to be discussing a primitive cell that was having trouble finding the right information in a plethora of spurious genetic material--no wait, it couldn't be a plethora, since spontaneous polymerisation of RNA is too rare for that, and the conditions required would kill most current life forms, if not all.

And you were accusing me of having the modern cells in mind too much.


And the two can be concurrent. It is entirely possible for base pairs to line up, and for that reason polymerize.


Except that the polymerisation experiments don't show this. Hard enough for a single strand to polymerise, so that it can only manage several base pairs, let alone two strands annealing concurrently with the polymerisation. Theoretically it might be possible, but even less likely than the current idea of abiogenesis, in my view.


Methinks you are confusing cell walls with plasma membranes.

The plethora of incorrect biology in this post is beginning to suggest to me that you either completely made up your career in the field, or that you went to the worst school on the planet.


So you like to throw the insult in every now and then, eh?


If evolutionary theory went against the predictions of the SLT2, then one of them would have to be wrong. You can't say, "This phenomenon goes against the predictions of this theory, but both of them might be right."


Rubbish. Because we don't know all there is to know about the SLT, nor evolutionary theory.



No, it would mean that your misunderstanding of the SLT2 would have to be changed. Those of us who actually understand the thermodynamics behind it don't need a change in the rule to see it.


Not necessarily misunderstanding, but a limited understanding. And I doubt that you understand enough of thermodynamics to see that abiogenesis is likely.


No, in this one you are trying to argue that you have always argued the exact opposite of what you have always said.


Prove it.


And you have also quite clearly stated that the lack of mentioning God is the disallowance of the existence or involvement of God. Which is what makes me wonder what exactly is going on in your head.


I did not. I said that the lack of allowing an alternative to a theory, even when theory is obviously flawed, is the problem. Better to live with an open question then embraced an obviously flawed idea. You almost just did it in the opening statement, though not quite. Something like abiogenesis must be right because life is currently present on earth.

I have even said to you on several occassions that I do not include God in my submitted papers. Makes me wonder if you are having trouble reading.


I suppose you could have forgotten every other thread in which we have had this discussion. I suppose you could have been saying one thing all along while meaning the exact opposite. But neither of these seems very likely.


I find it far more likely that you have taken what you thought I meant, as opposed to what I really did mean, since you have been doing that in virtually every post.


The only way to not do your science this way would be to inject something about the supernatural into science. And if you do that, it ceases to be science. If you do not bring the supernatural into science, then you are doing science as if the supernatural does not exist.


Wrong again. I do not address the supernatural in my science.
You simply are not getting it, it seems. Can it really be that difficult?


Because everything, no matter how sure you are of it, is open to question in science. There is no data that can absolutely only be consistent with one explanation, because there is always the chance that data will come along to disprove that explanation. We can never say that we have disproven all other possibilities, because we don't even know what all the other possibilities might be.


Not everything. The questions that a researcher thinks cannot be answered by science are obviously not open to question in his science (although the next scientist might feel differently).

And there may not be any data produced by the empirical method that can absolutely be consistent with only one explanation, but such is not the role of science anyway. It is incapable of providing absolute proof.


Nearly every proponent of ID has admitted that their "intelligent designer" is "God".


But that is irrelevant to the point. It would be the same sort of process whereby one distinguishes between manslaughter and murder. The point is over the presence of design, not the source of the design.


No, I mean advisor. I am currently working on my thesis and she is the principal investigator in the lab.


OK Best of luck with the writing.


No, believe me when I say he doesn't give Intelligent Deisgn more than a passing glance. My best guesses would be "Industiral Design" or "Integrated Design" or something along those lines. I'm not completely familiar with his field, so I can't be sure.


Fair enough.


Evolutionary theory doesn't claim that every organism will try and pass on its genes. In fact, it allows quite neatly for one that does not - such an organism will be selected out of existence.


I thought that the idea was that every organism will either try to pass on its own genes, whether those genes comes from self or a closely related individual.


Very slim. But so are many things that happen in the world.


But this is not like the lottery, where the chances of a person winning are close to 100%.


I was under the impression that we were talking about all mutations, not just those that confer antibiotic resistance.


If an organism aquires more DNA, there has to be a selection advantage in order for that organism to keep that DNA (depending to a certain extent on the size of the DNA--below 1kb is probably insignificant, both for genome growth and for extra energy required during DNA replication). I think there are relatively few alternatives to antibiotic resistance whereby an organism can recieve intact and functioning genes that are likely to confer an advantage.


Evolutionary theory does not preclude the shrinking of genomes - something you have admitted yourself.


Yes, but it does preclude the shrinking of all genomes, or almost all of them.


Nor does it in any way predict that speciation will not occur due to the loss of information.

Yes, but the theory looks weak in my opinion when all of the known cases of speciation can be attributed to loss of information, rather than a gain.


Why do your arguments always boil down to a complete misunderstanding of the theory you are arguing on?

Do they? What gives you that impression?

So you like to throw the insult in every now and then, eh?


Question: would the both of you be willing to reveal your real life identities and occupations, so the onlookers can determine your credentials ? Preferably with a link to a website that proves the claim you make (e.g. a homepage on a university/labs server).

So, you both agree that natural forces were used.

Then, you insist that supernatural forces were used, the others don't axiomatically accept that.

And you say THEY are being narrow.

On the contrary, I *allow* that both supernatural and natural forces were used, while they believe that only natural forces were involved. Can't you see the difference?


Bruaraong, you talk about having "one more option", but you don't regard the supernatural as an option, you keep stating it as a fact. To include it categorically is just as narrow as excluding it out of hand.

When I come to something like abiogenesis, I am not assuming that supernatural forces were involved, but I am skeptical of the idea that only natural forces were adequate.
I do consider that God exists, no question, but I am not assuming that he had to have created (through supernatural means). I consider everything I find, within science, from both the point of view that God was directly involved (e.g. creating bacteria as bacteria), and that he wasn't directly involved (things evolved).

The question of God's existence does not come up in my science, thus while my conviction of God's existence is just as 'narrow' as those who are convinced that He doesn't exists, my science will always have one more option than those who are convinced that he doesn't exist.


So, if it is narrow to not assume God's supernatural creation, is it more narrow to not also include the efforts and contribution of Shiva, Brahma, and Vishnu?


I am not assuming God's supernatural creation in particular instances. I don't know how many more times I have to say this so clearly. I have only assumed that a supernatural creation is possible, and that it can explain the presence of life on earth.

As for my personal belief in God (as opposed to Vishnu or Brahma), simply having a belief makes you 'narrow'. You cannot hold a world view without making some exclusions and rejections. If you believe that you exist, you have excluded the possibility that you do not exist. Thus being narrow, in that sense, is unavoidable, and not really a valid criticism. I suggest that you are possibly as 'narrow' as I am, in that regard.


Or is it only narrow to not assume and insist on supernatural effects inconsistent with your doctrine?

Ridiculous.

Question: would the both of you be willing to reveal your real life identities and occupations, so the onlookers can determine your credentials ? Preferably with a link to a website that proves the claim you make (e.g. a homepage on a university/labs server).

I could, but I would rather not. I'm sure you can appreciate why.

I'm not sure, but I suspect that if news got around that I was criticising evolutionary theory, I would have trouble getting my papers accepted, even if they contained no criticism of the theory. I might even lose my job and have trouble finding another. It really isn't worth it for a little debate like this one.

On the contrary, I *allow* that both supernatural and natural forces were used, while they believe that only natural forces were involved. Can't you see the difference?

Where do you draw the line for involvement though ? Just saying "a superior being did it" whenever you cannot explain an observation is after all completely useless - so you need to define some set of criteria.

What are they ?

I could, but I would rather not. I'm sure you can appreciate why.

Considering I am not planning on sharing my real name either I cannot blame you. Too bad though :(

Interesting post.


I think what you're missing is that it's that it's a "Selfish Gene" idea, not a "Selfish Individual".

I didn't think I missed that.


If a gene within a creature allows that creature to create 100% related offsprings (the drones, untainted by any 'father' DNA, and thus also 'birthable' without the need to attract/seek, vet and obtain the services of a male) that aid the survival of the self-same genes by serving that creature and the viably-reproductive offspring of that creature, then that gene has an advantage over the equivalent-but-different genetic sequence in a 'cousin' colony where no such mechanism occurs. Check out the details of "haplodiploidy" if you don't already know about it.


I certainly can understand the advantage of having a whole lot of drones running around helping to ensure the passing of genes, but my question was how this was supposed to develop, given that natural selection would have had to be involved in selecting genes that were strictly not passed on. It is one thing for individuals to be present that do not pass on genes, even though they are capable of it (e.g the spinster aunt who care for her nieces and nephews), but it is quite another to develop a drone that is incapable of passing on genes. I was wondering if this posed a problem for evolutionary theory, of if someone could explain it at a more detailed level than that it is simply possible.


Humanity has similar tendencies towards "supporting humanity". Some argue that a 'background' level of genetic tendency towards homo/asexuality is part of this "beneficial aunt or uncle" policy (two mothers are better than none, and spinster sisters have been invaluable assistants to those who become mothers in many societies) though there's a whole different kettle of fish in that argument.


I am well aware of the concept of kin selection. ''I would give my life for two brothers and eight first cousins'' type of stuff, i.e., expectation of cooperativity tend to vary proportionally with kinship distance. I'm also aware that this poses no problem for evolutionary theory, though it cannot rule out a scenario in which God created intelligent life in this way. However, human´behaviour regularly exhibits noncompensatory sacrifice for nonkin, and explaining such phenomena constitutes one the most controversial aspects of current evolutionary theory, as far as I have read about it.


To expand to the existence of 'unrelated' human assistants (priests, nuns, etc), it's just a matter of degrees. You may support your offspring. You may have no offspring but support your nieces and nephews. You may not have such close relatives but support your community. Your nation. Your race [edit: in hindesight, let's state that I mean colour, creed, other major population group with given shared characteristics]. You may support people who you believe need supporting (especially against people who you know are Doing Rather Too Well For Their Own Good, Thank You).


At some point, the consideration of kinship is lost. Does that mean the end of evolutionary theory? Do we discard the theory when it comes to humans?


Indeed, it's hard to find any reason why there might be any reason to have genes (that express any relevant phenotype, mentality, tendancy) that are not totally sociably amenable, save that there is a balance point whereby a low inherant level of sociopathic behaviour can survive if society as a whole is not damaged so much that the few 'cheaters' that do exist make their own existence untenable. But I don't wish to take this discussion into Game Theory.


'Cheaters' simply raise the cost of cooperative interactions.
But would you imply that Jesus' call to sacrificial love can be in any way compatible with evolutionary theory?


In short, individuals are individuals. Some individuals will be progenitors and some will not. To think otherwise would be like asking why we have elbows and knuckles and molars and spleens, because 'all' a body needs to are the respective gonads. (Yes, 'all' except the means for ensuring that said gonads, male and female, are housed within a suitably viable mechanism, to wit the human body, capable of consumption/processing of nutrients and of ensuring that the gametes within come in contact with the gametes of the complimentary pursuasion.)

I agree with this. I've no problem with some individuals passing on their genes and some not. That is not really the point in question.

Where do you draw the line for involvement though ? Just saying "a superior being did it" whenever you cannot explain an observation is after all completely useless - so you need to define some set of criteria.

What are they ?


Good question. But while I can speculate about this, I am still developing my ideas about this. Currently, I tend to think that where science reveals natural causes to be insignificant--not based on what we dont know but based on what we do--that this is an indication that we can attempt to interpret the data with regard to a designer (although this is not my area of research).

Good question. But while I can speculate about this, I am still developing my ideas about this. Currently, I tend to think that where science reveals natural causes to be insignificant--not based on what we dont know but based on what we do--that this is an indication that we can attempt to interpret the data with regard to a designer (although this is not my area of research).

Intruiging :) To a degree this is similar to what the ID people tried to do: create a concrete way to allow for divine interference in the scientific method.
They have sofar failed miserably; with the conclusions drawn from the ideas of design inference and irreducible complexity as they are defined now being logical fallacies; but maybe your method will be more promising.

I do think you should concentrate on actually formulating those principles before devising hypostheses that invoke a deity though. Without it you will always meet with the "science cannot refer to God" opposition - and without a set of well defined criteria that opposition is in fact quite right.

On the contrary, I *allow* that both supernatural and natural forces were used, while they believe that only natural forces were involved. Can't you see the difference?

They don't exclude supernatural forces. They just don't address them.

Meanwhile, you don't *allow* for supernatural forces. Or are you suddenly claiming you didn't say supernatural forces MUST be a part of the world? They actually follow the evidence wherever it leads. You just can't seem to decide if science can address God or not. Because sometimes you claim it can't be analyzed or evidenced by science and then ten minutes later you talk about how they are supposed to conclude that God did it and how you think science does evidence God. If you can't make up your mind, why are you bashing people who simply ignore it.?


When I come to something like abiogenesis, I am not assuming that supernatural forces were involved, but I am skeptical of the idea that only natural forces were adequate.
I do consider that God exists, no question, but I am not assuming that he had to have created (through supernatural means). I consider everything I find, within science, from both the point of view that God was directly involved (e.g. creating bacteria as bacteria), and that he wasn't directly involved (things evolved).

BS. I quoted you saying that you refuse to look for a source for an ancestor tree for bacteria because you don't believe it exists. Now, granted this was before you started to pretend to keep an open mind, but that doesn't make it go away.

The question of God's existence does not come up in my science, thus while my conviction of God's existence is just as 'narrow' as those who are convinced that He doesn't exists, my science will always have one more option than those who are convinced that he doesn't exist.

Your science that you said can't involve God? The postion you said you hold so clearly that you questioned Dem's reading comprehension when she said you thought God in science was impossible. Which is it? You science doesn't involve God or it does? Because you keep claiming your science has that option while simultaneously claiming it is not something that can be addressed by science.

So you think I fail to see that the methods of science are limited to nature? I don't think you have understood my position very much. Which is fine. You don't have to. But what both debating with me if you aren't going to at least try to understand me, sister? I don't think my position is really that hard to understand.

It is the very method of science that does not allow for God to be used in a scientific explanation. Unless, that is, you have a way to falsify God?
Dem, we have been through all this before. I agree with your first statement. And the answer to your question is 'no'.


I am not assuming God's supernatural creation in particular instances. I don't know how many more times I have to say this so clearly. I have only assumed that a supernatural creation is possible, and that it can explain the presence of life on earth.

Hmmm... let's look for evidence to the contrary.

For example, I do not believe that todays bacteria evolved from a common ancestor, because I believe that God created bacteria. I am not going to publish my belief in a paper, but I am also not going to search for an evolutionary tree for the different families of soil bacteria. I think this is perhaps where we are at odds.

As for my personal belief in God (as opposed to Vishnu or Brahma), simply having a belief makes you 'narrow'. You cannot hold a world view without making some exclusions and rejections. If you believe that you exist, you have excluded the possibility that you do not exist. Thus being narrow, in that sense, is unavoidable, and not really a valid criticism. I suggest that you are possibly as 'narrow' as I am, in that regard.

That's not the point. The person who doesn't address their spiritual beliefs with science leaves it completely open. The person that claims that any gap in science is evidence of God is not simply holding a belief. You are claiming that God did something that could just as easily be Shiva or Vishnu and the truly open-minded people are simply leaving the question open.

Ridiculous.
A strong rebuttal if I've ever heard one. Amusingly, I've quoted you specifically saying what you call ridiculous now. Must suck that we can quote you so easily, huh?

They don't exclude supernatural forces. They just don't address them.


When someone says something like 'Abiogenesis does look pretty unlikely, but because life exists on earth, then it must have happened'', I consider that a case of ruling out the possibility that God may have created life as life.


Meanwhile, you don't *allow* for supernatural forces. Or are you suddenly claiming you didn't say supernatural forces MUST be a part of the world?

I know that God interacts with humans today. I don't know if he did the same to create man as man.


They actually follow the evidence wherever it leads.

That's what we are all trying to do, hopefully. Personally, I think it fine if a naturalist wants to follow the evidence that he finds, and have no problem with that. I do the same.


You just can't seem to decide if science can address God or not. Because sometimes you claim it can't be analyzed or evidenced by science and then ten minutes later you talk about how they are supposed to conclude that God did it and how you think science does evidence God.

I think science does show evidence for God for those who believe that God exists, but perhaps not for those who have already ruled him out of either existence or a more active role than something like a big bang expert.

I don't think they (scientists) are supposed to conclude that God did it. I have been saying all along that it is better to live with an open question than to embrace a theory is obviously flawed. That would mean that a naturalist, rather than saying that abiogenesis must have happened (not because it is likely, but because there is no alternative) but to leave it open. I'm not saying that we shouldn't be looking at abiogenesis (even though I personally wouldn't bother). I reckon those chaps who are interested in it should go ahead and look. I don't criticise them for looking. I criticise them for thinking that their flawed theory must be the right one simply by eliminating alternatives through assumptions.


If you can't make up your mind, why are you bashing people who simply ignore it.?


I'm simply not bashing anyone. All I have tried to do is defend my own position. When someone suggests that I am being narrow, I reply by saying that I actually have one more option than a naturalist, so I am actually less narrow in that regard. Does that mean I have been bashing naturalists?



BS. I quoted you saying that you refuse to look for a source for an ancestor tree for bacteria because you don't believe it exists. Now, granted this was before you started to pretend to keep an open mind, but that doesn't make it go away.


Yes, I personally wouldn't go looking for an evolutionary tree, because I suspect it would be a waste of time. However, my naturalist friends are welcome to go ahead with it, and I would not criticise them for that, or bash them. Of course I would be very interested in what they find.


Your science that you said can't involve God? The postion you said you hold so clearly that you questioned Dem's reading comprehension when she said you thought God in science was impossible. Which is it? You science doesn't involve God or it does? Because you keep claiming your science has that option while simultaneously claiming it is not something that can be addressed by science.


OK. My science does NOT involve God, but my life does. Thus, since my science comes from my life, I suppose one could say that my science is influenced by my belief in God. Nothing unusual about that. Everyone has a world view, and they cannot help it when their world view influences their science. However, when I don a lab coat and get to work in a lab, while I might pray to God about my plans, decisions, results, etc., I don't actually have an experiment to test whether God is listening to my prayers. My faith says that he does hear me and that he speaks to me on a daily basis, encouraging me to be honest in my results, fair with my students, punctual when my boss wants that paper submitted, hard working, and gentle on the poor student who is struggling with family problems at home and can hardly concentrate on her work.
I realize that God is in my work, but not a factor to be measured or tested, as I think Dem was saying. I think she would like to take that further and say that God should not even be considered as a possible cause (not sure about that one) to explain some things in the natural world. I flatly disagree with her on that. Thus, while I know I cannot measure God in an experiment (and wouldn't want to anyway), I reckon I am perfectly entitled to explore the natural world with the view that God may have interacted with it through special creation.

I hope that clears it up.


The person who doesn't address their spiritual beliefs with science leaves it completely open.

In that case, I would have no problem with that person in that regard.



The person that claims that any gap in science is evidence of God is not simply holding a belief.

I don't go for the God of the gaps stuff. That is what people thought during Victorian times, perhaps, but I don't know anyone that goes for it nowadays. Gaps are an indication of the inadequacy of the theory, not a place to shove God.


You are claiming that God did something that could just as easily be Shiva or Vishnu and the truly open-minded people are simply leaving the question open.



I guess you didn't understand that point. Let me try again. Since my belief in God is based on my personal proof of God, I am perfectly entitled to be 'narrow', since my personal conviction of my experience with God counts as knowledge. It would be dishonest of me not to be 'narrow'.

However, when it comes to trying to explain how life came to be, I should not be narrow, because I don't have the knowledge of how God did it (either through creation or through natural processes). I certainly have my preferences, but it remains an open question. And I argue against people on both sides, in order to learn more about it, and to figure out my own preferences.



A strong rebuttal if I've ever heard one. Amusingly, I've quoted you specifically saying what you call ridiculous now. Must suck that we can quote you so easily, huh?

I thought it was an attempt at humour, on his (Saint Curie) part, so I replied in kind.

I reckon I am perfectly entitled to explore the natural world with the view that God may have interacted with it through special creation.


Of course... just don't pretend that is science.

Sure, God uses natural forces, but not only natural ones.

On the contrary, I *allow* that both supernatural and natural forces were used, while they believe that only natural forces were involved. Can't you see the difference?


What difference? You only "allow" for God to have used both, necesarrily.
Can you at least admit to that?

If one person says "The set surely includes {A}", you say "No, the set surely includes {A,B}", how is that less narrow?

Or are you going with your "narrow is just having a belief" bit?

On a separate note, as disinegenuous as I feel you're being, I think its very unfair that journals would be less likely to publish your work if they knew your religious beliefs. That is unjust, in my opinion.

What difference? You only "allow" for God to have used both, necesarrily.
Can you at least admit to that?


I am beginning to wonder if we are on the same wavelength here. What I can admit to is that I don't know if God used natural forces to bring about e.g. life, or if he used a special creation. I can't say, because I don't know. Thus I accept the possibility of either scenario.

What I am being 'narrow' about is that however life got here, God was responsible. But that 'narrowness' comes from my world view, not from my science. The 'narrowness' that comes from my world view is the same sort of 'narrowness' that comes from the world view of the naturalist, in which the possibility of God's interaction is ruled out. Neither of us is being more narrow at that stage.

However, when it comes to explaining how life came about, the naturalist will have one less option than I, because he can't allow that life was specially created, while I can.


On a separate note, as disinegenuous as I feel you're being, I think its very unfair that journals would be less likely to publish your work if they knew your religious beliefs. That is unjust, in my opinion.

It depends, really, since if the editor of the journal thinks it will lower the reputation of his/her journal, he/she wouldn't hesitate to reject a paper in order to save his/her job, or at least it would be an exceptional person that would risk their job over such a thing. That's just the way it goes.

Were you in my position, you might be able to see a lot more of what they say about anyone who might possibly be one of those wacko creationists. My professor tried several times to get me to include evolutionary relevant aspects in my thesis before I submitted it, even though my thesis didn't have much to do with evolution. I left it out, in the end, mostly because it was already too long. The reason why he wanted me to put the evolutionary tree of bacteria in there was because it would be an indication that I fully accept evolution theory, and thus more likely to get the thesis accepted. It's called kissing the sacred cow.

That's why when you read the Nature journal, the articles will nearly always make a reference to evolutionary theory, even if it is very not relevant, because it makes the paper more 'interesting', more like 'real science'.
One explanation is that that is because it is more like real science, the other is that there is a lot of predjudice against anyone who might possible be a critic of evolutionary theory. The absense of a reference to the 'holy' evolutionary theory might possibly indicate a critic.

You might think I'm being unrealistic and unfair. All I can say is--try it, and see for yourself. Then judge.

Of course... just don't pretend that is science.

I wouldn't dream of pretending that it is your 'science', Grave.

I am beginning to wonder if we are on the same wavelength here. What I can admit to is that I don't know if God used natural forces to bring about e.g. life, or if he used a special creation. I can't say, because I don't know. Thus I accept the possibility of either scenario.

The "wavelength" difference seems to be that you have stated, declaratively, that God does not use only natural means.

Sure, God uses natural forces, but not only natural ones.

and now you're backpedalling of it, claiming you don't know. You're posturing yourself as openminded because you insist on God's actions (both natural and supernatural, as just quoted), while other's don't.


What I am being 'narrow' about is that however life got here, God was responsible. But that 'narrowness' comes from my world view, not from my science. The 'narrowness' that comes from my world view is the same sort of 'narrowness' that comes from the world view of the naturalist, in which the possibility of God's interaction is ruled out. Neither of us is being more narrow at that stage.

Very true. I believe you are equally as narrow as somebody who discounts any possibility of God, and you are equally well-supported.


It depends, really, since if the editor of the journal thinks it will lower the reputation of his/her journal, he/she wouldn't hesitate to reject a paper in order to save his/her job, or at least it would be an exceptional person that would risk their job over such a thing. That's just the way it goes.


Then is the editor not just the victim of the same injustice?


Were you in my position, you might be able to see a lot more of what they say about anyone who might possibly be one of those wacko creationists. My professor tried several times to get me to include evolutionary relevant aspects in my thesis before I submitted it, even though my thesis didn't have much to do with evolution. I left it out, in the end, mostly because it was already too long. The reason why he wanted me to put the evolutionary tree of bacteria in there was because it would be an indication that I fully accept evolution theory, and thus more likely to get the thesis accepted. It's called kissing the sacred cow.

And you don't see how that is unjust? I repeat that I don't agree with your position, but the merit of your scientific work (whatever that may be) should not be dismissed because of your religious beliefs.


That's why when you read the Nature journal, the articles will nearly always make a reference to evolutionary theory, even if it is very not relevant, because it makes the paper more 'interesting', more like 'real science'.
One explanation is that that is because it is more like real science, the other is that there is a lot of predjudice against anyone who might possible be a critic of evolutionary theory. The absense of a reference to the 'holy' evolutionary theory might possibly indicate a critic.

You might think I'm being unrealistic and unfair. All I can say is--try it, and see for yourself. Then judge.

I've had it described to me by friends over in Biochemistry and Biology, and I've judged it as unfair. What you've described seems to support that judgement, don't you see?

I don't go for the God of the gaps stuff. That is what people thought during Victorian times, perhaps, but I don't know anyone that goes for it nowadays. Gaps are an indication of the inadequacy of the theory, not a place to shove God.

Ha. You really should reread your posts before you post stuff like this. Unless you're just trying to amuse people. Give me a bit and I'll quote you saying that gaps are evidence of God.

By the way, do you usually refuse to look for evidence to explain something when you have no idea how it happened? You keep claiming you don't know how or where God was involved in creation but you've openly stated that you will not look for evidence of an ancestor tree. It seems pretty clear that you've ruled out natural causes despite your bizarre claims to the contrary.

I also think it's hilarious that you keep accusing people who actually have an open mind and thus continue to research the creation of life as naturalists. Hilarious. Leave that post unchanged. I can't wait to quote it later when you pretend you're not accusing people who simply keep an open mind of being naturalists.

That is almost exactly the sort of problem I have with your thinking. e.g. abiogenesis must be true because life exists.

I didn't say that - or anything remotely suggesting it. Please try again.

No, I stated clearly that I was referring to the basic requirements for life, like a cell barrier and an energy system.

You stated that after the fact - in a conversation that started when talking about complex enzymatic processes - processes that are not "basic requirements for life".

What are you talking about? RNases are the cause of RNA instability, and the presence of the hydroxyl group is irrelevant by comparison.

RNAses don't cause instability. They actively attack a molecule and break it down. Saying that they "cause instability" would be like saying, "Murderers cause instability in a human being." RNA itself, however, is inherently unstable because of its hydroxyl group, and will break down faster than DNA even in the absence of all RNAses.

When I perform RTPCRs, I always have a primary step which heats the RNA to 94 degrees C for a few minutes, before it is copied by the reverse transcriptase.

That's interesting, considering that heating to that temperature would destroy the RT.

The cancerous cell would be in a modern cell with all other controls in place, allowing growth. Instead, we were supposed to be discussing a primitive cell that was having trouble finding the right information in a plethora of spurious genetic material--no wait, it couldn't be a plethora, since spontaneous polymerisation of RNA is too rare for that, and the conditions required would kill most current life forms, if not all.

And you were accusing me of having the modern cells in mind too much.

No, I was simply pointing out the very clear fact that life does not require those controls. When cells lose those controls, they still continue to live.

Except that the polymerisation experiments don't show this.

Last time I checked, we actually have seen self-replicating RNA.

So you like to throw the insult in every now and then, eh?

It isn't an insult - just an observation.

Rubbish. Because we don't know all there is to know about the SLT, nor evolutionary theory.

Both the SLT and evolutionary theory are theories created by human beings. If they contradict each other, one or the other must be wrong, and needs to either be thrown out or modified to fit all the data. This is how science works, my dear.

Not necessarily misunderstanding, but a limited understanding.

The two aren't always different. In this case, your limited understanding of what we already know has led you to misunderstand the implications of the law.

And I doubt that you understand enough of thermodynamics to see that abiogenesis is likely.

I never said thermodynamics definitively states that abiogenesis or evolution are likely. I simply pointed out that there is nothing in at all in the SLT2 that would predict against either - not if you actually understand the law.

I did not. I said that the lack of allowing an alternative to a theory, even when theory is obviously flawed, is the problem.

Science never fails to allow alternatives to a theory. The very methods of science demand that a theory is always open to question.

Something like abiogenesis must be right because life is currently present on earth.

Even if God said "poof" and life appeared, that would, in the end, be a form of abiogenesis. The fact that life exists, and has not always exists, directly suggests that abiogenesis, in some form, occurred.

I have even said to you on several occassions that I do not include God in my submitted papers. Makes me wonder if you are having trouble reading.

Indeed. And you have also told me that the only reason you don't is that you wouldn't get published otherwise.

Wrong again. I do not address the supernatural in my science.
You simply are not getting it, it seems. Can it really be that difficult?

No, you are the one who isn't getting it. If you do not address the supernatural in your science, then you conduct science as if the supernatural does not exist - as if only the natural exists. If you claim that you do not conduct science as if only the natural exists, the only way that can possibly be true is if you inject the supernatural into it.

And there may not be any data produced by the empirical method that can absolutely be consistent with only one explanation, but such is not the role of science anyway. It is incapable of providing absolute proof.

Exactly my point. Thank you for agreeing with the original statement, which was, "It is completely unscientific, however. You cannot possibly find data that "can only be consistent with...." using the scientific method."

But that is irrelevant to the point. It would be the same sort of process whereby one distinguishes between manslaughter and murder. The point is over the presence of design, not the source of the design.

With manslaughter and murder, we know that a possible murderer exists. We can and do assume that human beings exist that might have done something that we have observed human beings doing.

God on the other hand, has not been empirically observed, and one cannot possibly find the presence of a design without assuming the presence of a designer.

I thought that the idea was that every organism will either try to pass on its own genes, whether those genes comes from self or a closely related individual.

And, once again, you demonstrate your lack of understanding of the theory. Nothing in evolutionary theory states that an organism will try to pass on its genes. It simply says that those traits which do help it to do so will increase the chances of its traits becoming common in the species (ie. natural selection). If a genetic trait leads to an organism not trying to ensure the survival of its genes, then its genes are likely to, well, not survive.

If an organism aquires more DNA, there has to be a selection advantage in order for that organism to keep that DNA (depending to a certain extent on the size of the DNA--below 1kb is probably insignificant, both for genome growth and for extra energy required during DNA replication).

Wrong. Only if the extra DNA causes a measureable disadvantage would we expect it to be selected out of the population. Otherwise, it might not be selected *for*, but it won't be selected out either. And, eventually, there is a chance that it might become something that is a selective advantage.

Yes, but it does preclude the shrinking of all genomes, or almost all of them.

No, it doesn't. It would preclude all genomes throughout all time shrinking, but it would not preclude all observed genomes at this time shrinking. Keep in mind that, in evolutionary terms, we haven't been watching very long.

Do they? What gives you that impression?

The fact that it is true. These conversations generally end up with everyone and their brother having to correct you, even on basic biology.

The question of God's existence does not come up in my science, thus while my conviction of God's existence is just as 'narrow' as those who are convinced that He doesn't exists, my science will always have one more option than those who are convinced that he doesn't exist.

This doesn't make logical sense. An atheist could just as well say:

"The question of God's existence does not come up in my science, thus whil emy conviction in the lack of a God is just as 'narrow' as those who are convinced that God does exist, my science will always have one more option than those who are convinced that God does exist."

Neither quote makes sense, because if God is not being considered by science - if the question of God's existence does not come up in science - then neither a lack of belief nor a belief in God adds any options at all to the science.

I realize that God is in my work, but not a factor to be measured or tested, as I think Dem was saying. I think she would like to take that further and say that God should not even be considered as a possible cause (not sure about that one) to explain some things in the natural world.

I don't rule God out of anything. However, in the context of science, we cannot consider "God" as a possible cause, because God is both untestable and unfalsifiable. Science cannot consider God - something you have admitted to, while flailing against it with comments like these. Make up your mind, can God be used as a scientific explanation, or not?

Science must observe without prejudice, this means not making assumptions about the cause or source of an event. If someone makes observations "knowing full well God is the cause of all things," then this person can and will "find" their evidence.


I believe there is a supreme being, which for present purposes could be called "God." I think there are some strong logical and empirical cases to be made for the existence of a supreme being. But I will not pretend for a moment that anything an observer or logician could ever find or deduce would "prove the existence of God." God is unprovable by virtue of its very relationship with existence.


As far as the 2nd law of thermodynamics is concerned there actually is an interesting case to be made. The universe's background radiation is the same temperature across the universe. This shouldn't be possible, and it is the reason why scientists have come up with some down-right wacky theories like expansion or variable speed of light to explain this occurrence.



On a related note which seems to be slowly turning into the topic at hand I think science would do well to stop "confronting" religion and start "addressing" it. Science has for a long time left questions of metaphysics and cosmology (as in after-life) to philosophers, theologians, and mystics. Science has effectively taken up a passive role areas where science is less apt to be able to give a definitive answer. This essentially allows people to come with all kinds of wild non-sense and without a credible institution to discredit the "non-sense" it may flourish. Now I'm not going to sit here and try and tell everyone that science has or can get an answer to everything, but it is a good starting block.

NT

On a related note which seems to be slowly turning into the topic at hand I think science would do well to stop "confronting" religion and start "addressing" it. Science has for a long time left questions of metaphysics and cosmology (as in after-life) to philosophers, theologians, and mystics. Science has effectively taken up a passive role areas where science is less apt to be able to give a definitive answer.

As it should - science is not suited to "address" these things. Unless you can devise criteria and research methods that encompass them ?

On a related note which seems to be slowly turning into the topic at hand I think science would do well to stop "confronting" religion and start "addressing" it. Science has for a long time left questions of metaphysics and cosmology (as in after-life) to philosophers, theologians, and mystics. Science has effectively taken up a passive role areas where science is less apt to be able to give a definitive answer. This essentially allows people to come with all kinds of wild non-sense and without a credible institution to discredit the "non-sense" it may flourish. Now I'm not going to sit here and try and tell everyone that science has or can get an answer to everything, but it is a good starting block.
NT

So, are we proposing that science be brought to bear on metaphysical questions?

As you say, there are realms in which science is "less apt to be able to give a definitive answer".

Will there not likely remain religious or spiritual premises which, by nature, evade science (which I believe to be necessarily and beneficially limited to that which can be tested, measured, experimented on, and so forth)?

I'm sorry, I'm just not sure I'm following what you propose be done. Can you give an example of science "addressing" religion as you describe? I don't consider the idea wrong, I'm just not completely seeing it.

I certainly can understand the advantage of having a whole lot of drones running around helping to ensure the passing of genes, but my question was how this was supposed to develop, given that natural selection would have had to be involved in selecting genes that were strictly not passed on. It is one thing for individuals to be present that do not pass on genes, even though they are capable of it (e.g the spinster aunt who care for her nieces and nephews), but it is quite another to develop a drone that is incapable of passing on genes. I was wondering if this posed a problem for evolutionary theory, of if someone could explain it at a more detailed level than that it is simply possible.How might it develop? As per everything else, by chance. If, by chance, a mutation occured that said "sire a number of fatherless offspring without chance of self-progeniting but with enhanced communal duties instead", then the colonies with that mutation[1]", the colony would be capable of outcompeting colonies without that advantage. I don't know which 'direction' the whole insect colony world came from, but a concentrated 'single-germline' would[2], in survivng colonies, could easily lead to the domination of this type of behaviour.

Not much flexibility, per generation, but we're talking about quick-lived creatures who live in fairly static environments who have developed most of the little nacks they need to develop to survive their normal environment. Andeven a lot of the challenges the 'newcomer' humans try to put upon them (either deliberately by extermination or incidentally through habitat erosion/environmental effects).

I'm also aware that this poses no problem for evolutionary theory, though it cannot rule out a scenario in which God created intelligent life in this way.And, as has been said, evolutionary theory does not rule out the latter scenario, either, you know. It just doesn't rule it 'in' either. But haven't we been here before?

However, human´behaviour regularly exhibits noncompensatory sacrifice for nonkin, and explaining such phenomena constitutes one the most controversial aspects of current evolutionary theory, as far as I have read about it.That's because we're beyond mere instinct, through the domain of intelligence (which a lot of pack animals have) and now possess "extelligence". While it's not proven one way or another whether 'dumb animals' have the same kind of empathies (well, I know of various primate experiments that have approached proof, but the rest is just conjecture, AFAIK) our unique ability to communicate beyond the bounds (across spacial and temporal boundaries) of 'one-on-one' contact and even scent-marking, individuals are capable of acknowledging and acting on more than "I see my cubs in trouble, I move to defend them" cues, but are capable of acting to (for example) prevent the re-arising of fascism upon observing the precursor signs of discontent among certain classes of society or negate the shortfalls of inadequate agricultural policies n distant lands...

'Cheaters' simply raise the cost of cooperative interactions.
But would you imply that Jesus' call to sacrificial love can be in any way compatible with evolutionary theory?'Cheaters' raise the costs, but in a world (otherwise) full of non-cheaters, a lone cheater can thrive while normally having little impact upon the otherwise idyllic system. In a world full of cheaters, it's generally all downhill. At some balance point (mostly fair, some cheating) enough cheaters emerge to require social rules among the 'fair' people to control cheating, yet there's enough wiggle room for this limited cheating to occur. It's a conclusion compatible with Game Theory, which is a different subject.

Jesus's (or Buddha's or Mohammed's or Bob Geldof's or anyone else's) call for some kind of personal sacrifice on behalf of others is a slightly different thing (not a balance against cheaters, but certainly against-the-trend-of-cheating behaviour) which I suspect we could discuss if you want to.



[1] Ok, several minor ones, but I'm compressing what could be arrived at in stages to a single statement for brevity.
[2] Despite germline 'perfection' (due to an unfortunate accident beyond handling by any practical genetic pre-programming), or because of germline 'bufferlessness' (due to a suboptimal element of the germline being spread throughout the colony).

But would you imply that Jesus' call to sacrificial love can be in any way compatible with evolutionary theory?

Well.. Jesus did not reproduce ;)

Isn't that so hypocritical. Ignore the proof beyond reasonable doubt for big bang. Ignore general relativity. Ignore carbon dating. But because the Second Law of thermodynamics can be interpreted in a dodgy way to suggest supernatural forces, then it's absolute truth. Then they acknowledge science. Damn christians.

Isn't that so hypocritical. Ignore the proof beyond reasonable doubt for big bang. Ignore general relativity. Ignore carbon dating. But because the Second Law of thermodynamics can be interpreted in a dodgy way to suggest supernatural forces, then it's absolute truth. Then they acknowledge science. Damn christians.

To be fair, I think Dempubliscents1 and/or Jocabia might be Christians, and they have done a lot to pretty much shred Bruarong's position throughout this thread. I know its a big one, but look through if you get a chance.

I know how you feel, though...

To be fair, I think Dempubliscents1 and/or Jocabia might be Christians, and they have done a lot to pretty much shred Bruarong's position throughout this thread. I know its a big one, but look through if you get a chance.

I know how you feel, though...

The christians who realise that science and religion aren't incompatible don't irritate me as mch. But the ones who chose to take the literal word of a book over experimentation and observation are just ignorant.

I'll look through it when I get some time.

The christians who realise that science and religion aren't incompatible don't irritate me as mch. But the ones who chose to take the literal word of a book over experimentation and observation are just ignorant.

I'll look through it when I get some time.

I'm on board with having more respect for religious (or other) people that don't take science and religion as incompatible.

On the "do you have faith in God" forum, I'm having a hell of a time even getting some to say whether they regard the bible as inerrantly true or not.

Well.. Jesus did not reproduce ;)
Didn't say he didn't try. Remember the salamander house he used to "hang out" in. ;)

I'm on board with having more respect for religious (or other) people that don't take science and religion as incompatible.

On the "do you have faith in God" forum, I'm having a hell of a time even getting some to say whether they regard the bible as inerrantly true or not.

You would have a hard time with that. Both options, true and not completely true, are open to massive attack.

You would have a hard time with that. Both options, true and not completely true, are open to massive attack.

People take untennable positions all the time, though. I just want them to declare their position. If they want to pick and choose which parts they consider valid or "godsent" or whatever, I want to understand their basis for doing so.

People take untennable positions all the time, though. I just want them to declare their position. If they want to pick and choose which parts they consider valid or "godsent" or whatever, I want to understand their basis for doing so.


Oh of course. People frequently take untennable positions. But perhaps the person you're debating with doubts his/her ability to argue such a position.

and now you're backpedalling of it, claiming you don't know. You're posturing yourself as openminded because you insist on God's actions (both natural and supernatural, as just quoted), while other's don't.


I insist on the possibility of God being capable of both natural and supernatural actions--and always have. No backpedaling there.


Then is the editor not just the victim of the same injustice?

And you don't see how that is unjust? I repeat that I don't agree with your position, but the merit of your scientific work (whatever that may be) should not be dismissed because of your religious beliefs.

I've had it described to me by friends over in Biochemistry and Biology, and I've judged it as unfair. What you've described seems to support that judgement, don't you see?

Oh, I think I got you wrong. I thought you were calling my judgement unjust, when you were really describing the current situation as unjust. My apologies.

How might it develop? As per everything else, by chance. If, by chance, a mutation occured that said "sire a number of fatherless offspring without chance of self-progeniting but with enhanced communal duties instead", then the colonies with that mutation[1]", the colony would be capable of outcompeting colonies without that advantage. I don't know which 'direction' the whole insect colony world came from, but a concentrated 'single-germline' would[2], in survivng colonies, could easily lead to the domination of this type of behaviour.

But we don't know that the mutation that resulted in the drones not passing on their genes, but specifically enabling the queen to keep her reproductive capabilities was a simple one, or a simple few mutations. For all we know, it could have required thousands of mutations, particularly if they would have to be point mutations. And we only have natural selection to account for all the mutations coming together for the amazing result. What we have is an explanation that doesn't seem to be supported by any empirical evidence, as far as I can see (which isn't all that far).


And, as has been said, evolutionary theory does not rule out the latter scenario, either, you know. It just doesn't rule it 'in' either. But haven't we been here before?


Yeah, I think we have. My point is not that evolutionary theory lacks explanations, but that it lacks empirical evidence, and details models about how such developments are possible. For example (I got this from reading an article by Michael J. Behe, and IDer), the Journal of Molecular Evolution, specifically begun to deal with the topic of how evolution occurs on the molecular level, has published over a thousand papers between the years 1986 to 1996. Of these, about 100 discussed the chemical synthesis of molecules thought to be necessary for the origin of life, about 50 proposed mathematical models to improve sequence analysis, and about 800 were analyses of sequences. There was actually not a single paper discussing detailed models for intermediates in the development of complex biomolecular structures. He also mentions that this is by no means a perculiarity with JME, and lists PNAS, Nature, Science, and the Journal of Molecular Biology.

Why is this lack? Obviously, because devising such models are too hard. But why are they too hard?


That's because we're beyond mere instinct, through the domain of intelligence (which a lot of pack animals have) and now possess "extelligence". While it's not proven one way or another whether 'dumb animals' have the same kind of empathies (well, I know of various primate experiments that have approached proof, but the rest is just conjecture, AFAIK) our unique ability to communicate beyond the bounds (across spacial and temporal boundaries) of 'one-on-one' contact and even scent-marking, individuals are capable of acknowledging and acting on more than "I see my cubs in trouble, I move to defend them" cues, but are capable of acting to (for example) prevent the re-arising of fascism upon observing the precursor signs of discontent among certain classes of society or negate the shortfalls of inadequate agricultural policies n distant lands...


If we humans are evolved beyond mere instinct, how did we do that? Through the evolutionary process? Wouldn't that exclude or at least marginalise intelligence that tends to decrease reproducibility? OK, we do have homosexuals in modern communities, most of which do not pass on their genes. But we don't have close to 100% homosexuality, or we wouldn't for long. But we do have human characteristics of love and self-sacrifice. Indeed, humans, and even animals, sacrifice their own lives to preserve those of genetically unrelated lives.


'Cheaters' raise the costs, but in a world (otherwise) full of non-cheaters, a lone cheater can thrive while normally having little impact upon the otherwise idyllic system. In a world full of cheaters, it's generally all downhill. At some balance point (mostly fair, some cheating) enough cheaters emerge to require social rules among the 'fair' people to control cheating, yet there's enough wiggle room for this limited cheating to occur. It's a conclusion compatible with Game Theory, which is a different subject.


OK Fair enough.


Jesus's (or Buddha's or Mohammed's or Bob Geldof's or anyone else's) call for some kind of personal sacrifice on behalf of others is a slightly different thing (not a balance against cheaters, but certainly against-the-trend-of-cheating behaviour) which I suspect we could discuss if you want to.


Some people have suggested that such calls to 'love your neighbour as yourself' runs contrary to the inclusive fitess of the genes, even though it promotes social cooperation and peace of mind.

''If one believes that humans are designed to be loving organisms, then it is a reasonable hypothesis that behaviour which is generous towards others might actually increase fitness, not because it increases social status and therefore inproves access to resources, but because even if resources are relinquished, it may imporve utilization efficiency or result in psychoneurological states that promote immunity, learning, vitality or other aspects of well-being. There are all testable hypotheses that do not require a commitment to supernatural agency before one investigates them, much less conceives of them.''
J. P. Schloss

This chap seems to be saying that if evolutionary theory is allowed to have explanations without empirical evidence, then intelligent design is certainly allowed to pursue their own explanations, particularly ones that can be tested by the empirical method.

Well.. Jesus did not reproduce ;)
True (as far as we know), but perhaps he contributed to greater reproduction by encouraging more stable communities (where everyone loved their neighbour), resulting in bigger families (initially) and then more research into ways to prevent death through sickness, etc., etc.

Ha. You really should reread your posts before you post stuff like this. Unless you're just trying to amuse people. Give me a bit and I'll quote you saying that gaps are evidence of God.

Gaps are not (necessarily) evidence of God, they are evidence of an inadequate explanation.


By the way, do you usually refuse to look for evidence to explain something when you have no idea how it happened? You keep claiming you don't know how or where God was involved in creation but you've openly stated that you will not look for evidence of an ancestor tree. It seems pretty clear that you've ruled out natural causes despite your bizarre claims to the contrary.


There is a difference between ruling out the possibility of natural causes being adequate to explaing the presence of bacteria, and ruling out personally looking for them. I think my own choice of research is far more interesting, and more likely to get results.



I also think it's hilarious that you keep accusing people who actually have an open mind and thus continue to research the creation of life as naturalists.

Do you think ruling out the possibility of creation is the result of an open mind? I think you have it wrong.

Do you think ruling out the possibility of creation is the result of an open mind?

I fear that in practive it does, yes. It forces you to think about other possibilities than the simple "God did it", even the implausible ones.

Again: without a set of welldefined criteria, "God did it" is a useless statement.

I didn't say that - or anything remotely suggesting it. Please try again.

Well, if you don't take that position, I cannot criticise you for that.



You stated that after the fact - in a conversation that started when talking about complex enzymatic processes - processes that are not "basic requirements for life".


So you think 'basic' life does not require complex enzymatic processes? That would be even more incredible.


RNAses don't cause instability. They actively attack a molecule and break it down. Saying that they "cause instability" would be like saying, "Murderers cause instability in a human being." RNA itself, however, is inherently unstable because of its hydroxyl group, and will break down faster than DNA even in the absence of all RNAses.


Biochemical instability of RNA (under research conditions) is due to the presence of RNase enzymes on labware and human hands, and the fact that RNA is chemical unstable due to 2'-3' cyclic phosphate formation (i.e. the hydroxide group). As to which one causes a higher degree of instability in nature, I am suggesting that it is the RNases, although it would depend on circumstances. Perhaps in viruses, there are circumstances where the RNases are lacking, or not so prevalent.

The presence of a murderer in the same room with you would decrease your safety, wouldn't you say? The safety of your life would no longer be so 'stable'.


That's interesting, considering that heating to that temperature would destroy the RT.


Apparently not. I use the Qiagen kit. 94 degrees. 3 min. I always get results that give me the approximate initial number of RNA molecules, allowing me to determine relative levels of gene expression.


No, I was simply pointing out the very clear fact that life does not require those controls. When cells lose those controls, they still continue to live.


In cancerous cells, there is usually a single mutation, which removes the control that prevents uncontrolled cell division. This is hardly a fair comparison to the primitive cell considered in abiogenesis. In fact, quite irrelevant. I never said that all of the controls in a modern cell are necessary in order for it to survive.


Last time I checked, we actually have seen self-replicating RNA.


''the myth of a self-replicating RNA molecule that arose de novo from a soup of random polynucleotides. Not only is such a notion unrealistic in light of our current understanding of prebiotic chemistry, but it would strain the credulity of even an optimist's view of RNA's catalytic potential.''

Gerald Joyce and Leslie Orgel, In the RNA World

The concept of "self-replicating RNA" is a complete product of fantasy, and actually this kind of RNA has not been produced in any experiment.


It isn't an insult - just an observation.


It's an insult unless you can provide a good reason for it.


Both the SLT and evolutionary theory are theories created by human beings. If they contradict each other, one or the other must be wrong, and needs to either be thrown out or modified to fit all the data. This is how science works, my dear.



We are not talking about contradictions, but forces that work in opposite directions, such as inertia and momentum. The result is not a contradiction, but a collision.


The two aren't always different. In this case, your limited understanding of what we already know has led you to misunderstand the implications of the law.


And you have not convinced me that you know much (if any) more than I.


I never said thermodynamics definitively states that abiogenesis or evolution are likely. I simply pointed out that there is nothing in at all in the SLT2 that would predict against either - not if you actually understand the law.


Laws actually don't make predictions. Humans do. And I think that if you take into consideration the implications of SLT, and the other available forces and conditions that were most likely present at abiogenesis, I think any intelligent human can make the prediction that abiogenesis would not have occurred. The ones who don't are faithful believers in the concept that everything can be explained by nature forces.


Science never fails to allow alternatives to a theory. The very methods of science demand that a theory is always open to question.


Are you talking about science or people within science? Because there are plenty of people who do not allow creation as an alternative, despite having no evidence against it.


Even if God said "poof" and life appeared, that would, in the end, be a form of abiogenesis. The fact that life exists, and has not always exists, directly suggests that abiogenesis, in some form, occurred.


But in our discussion of abiogenesis, it has always meant the formation of life in the absence of supernatural means. Don't go changing the parameters now.


Indeed. And you have also told me that the only reason you don't is that you wouldn't get published otherwise.


Not the only reason, and perhaps not the major one, but one of them, sure.


No, you are the one who isn't getting it. If you do not address the supernatural in your science, then you conduct science as if the supernatural does not exist - as if only the natural exists.

No. There is no reason to approach science as if God does not exist. It simply is not necessary, despite your repetitive claims.


If you claim that you do not conduct science as if only the natural exists, the only way that can possibly be true is if you inject the supernatural into it.


No, there is no reason to inject the supernatural in it either. The existence of God is never questioned in my science, since it is not part of the experiment. God is always there.


Exactly my point. Thank you for agreeing with the original statement, which was, "It is completely unscientific, however. You cannot possibly find data that "can only be consistent with...." using the scientific method."


I see that I should not have put the word 'only' in there. Rather, I should have said that the data can 'only be reasonable interpreted as consistent with a creator'. In other words, alternative explanations would not reasonable enough to be considered likely.


With manslaughter and murder, we know that a possible murderer exists. We can and do assume that human beings exist that might have done something that we have observed human beings doing.


And someone who believes in God should be able to allow that God may have done something that is consistent with his knowledge of God.


God on the other hand, has not been empirically observed, and one cannot possibly find the presence of a design without assuming the presence of a designer.


One can postulate the presence of a designer, and then look to see if the data fits with that postulation, without necessarily assuming that there is a designer, which is not quite my position, since I assume that God is present. But I am not an IDer. I'm not even a strict creationist, because I believe that God may have created, not assuming that He did created. But even if I did assume that He created, I still think that I am capable of discovering truth about the material world through empirical methodology.


And, once again, you demonstrate your lack of understanding of the theory. Nothing in evolutionary theory states that an organism will try to pass on its genes. It simply says that those traits which do help it to do so will increase the chances of its traits becoming common in the species (ie. natural selection). If a genetic trait leads to an organism not trying to ensure the survival of its genes, then its genes are likely to, well, not survive.


I understand that. In the context of what I was saying, the existence of successful species indicates that their ancestors were successful in passing on their genes. So that any trait in humans that decreases the chances of passing on genes would have been selected against. Of course a bacteria can't 'want' to pass on it's genes, and I was never suggesting that. It's because successful reproducers are selected that results successful traits, and the marginalisation of other traits, giving the impression that these individuals 'want' to pass on their genes.

You don't like the way I put things, and take that to mean that I don't understand the theory, which is a mite silly of you. If you feel you must correct me, why take that to mean that it is because you know it better than me?



Wrong. Only if the extra DNA causes a measureable disadvantage would we expect it to be selected out of the population. Otherwise, it might not be selected *for*, but it won't be selected out either.

Which is what I said. I suggested that any DNA over 1 kb (just a guess) in length might cause a measureable disadvantage, requiring extra energy during DNA replication and cell division.


And, eventually, there is a chance that it might become something that is a selective advantage.


Yet another explanation that has either no empirical evidence for, or very little.


No, it doesn't. It would preclude all genomes throughout all time shrinking, but it would not preclude all observed genomes at this time shrinking. Keep in mind that, in evolutionary terms, we haven't been watching very long.


So you need to invent an explanation that adequatly explains how the genomes are strinking now, but have generally been growing otherwise. And then you could find some empirical evidence while you are at it. Good luck.


The fact that it is true. These conversations generally end up with everyone and their brother having to correct you, even on basic biology.

'Everyone and their brother' means you, I suppose.

I fear that in practive it does, yes. It forces you to think about other possibilities than the simple "God did it", even the implausible ones.

Again: without a set of welldefined criteria, "God did it" is a useless statement.

I am perfectly capable of considering other possibilities than the simple ''God did it'', without ruling out the possibility the God simply did it.

It might be a useless statement to someone in your position, but that doesn't make it untrue, or even useless.

I am perfectly capable of considering other possibilities than the simple ''God did it'', without ruling out the possibility the God simply did it.

Sure - but at which point do you stop looking for alternatives and choose to say that "God did it" ? If you can define that, by all means: go ahead.

It might be a useless statement to someone in your position, but that doesn't make it untrue, or even useless.

I never said it was untrue. In a scientific setting without criteria it however *is* a useless statement, since it is no different then "I do not know".

Sure - but at which point do you stop looking for alternatives and choose to say that "God did it" ? If you can define that, by all means: go ahead.

You don't have to stop until you find a good way that rules out any reasonable alternatives.



I never said it was untrue. In a scientific setting without criteria it however *is* a useless statement, since it is no different then "I do not know".

The truth is that we do not know. Being true does not make it useless.

Gaps are not (necessarily) evidence of God, they are evidence of an inadequate explanation.

Yes and if that was what you said, I might buy that. And, in science, gaps are not evidence of an inadequate explanation. If it's a bad explanation we disprove it. No one has been able to do that with evolution.

There is a difference between ruling out the possibility of natural causes being adequate to explaing the presence of bacteria, and ruling out personally looking for them. I think my own choice of research is far more interesting, and more likely to get results.

That's not the point. You plainly said you won't look and you think it shouldn't be funded. You've also repeatedly stated the only people looking for such explanations are naturalists. Stop pretending to be open-minded and the "I don't assume God interfered any specific place" when you are unwilling to consider any other explanation than the one you've decided to be true.


Do you think ruling out the possibility of creation is the result of an open mind? I think you have it wrong.
Can you introduce me to anyone who ruled out the possiblity of creation? Most people are simply willing to keep looking for evidence and see where it leads. You consider yourself open-minded for refusing to look for evidence that doesn't match your beliefs and them close-minded for continuing to look for evidence on which to base their beliefs. You have a strange definition of open-minded and close-minded.

Meanwhile, you keep saying you aren't accusing the scientists looking at these theories of being naturalists every time we press you on it and then a minute later you're calling them naturalists. It's pretty funny. I actually show your posts around my office for giggles and this is an office where they say a prayer at every company meeting. I guess my cohorts can tell the difference between beliefs and science.

I am perfectly capable of considering other possibilities than the simple ''God did it'', without ruling out the possibility the God simply did it.

But apparently they aren't. You accuse people who look for other possiblities than God did it as naturalists. That's why you suggest people looking for an evolutionary tree of being are naturalists. Seriously, do you even read what you write.

It might be a useless statement to someone in your position, but that doesn't make it untrue, or even useless.

Other than the fact they are continuing to look for evolutionary evidence do you have that they're ruling out God, because you just said you do that without ruling out God.

This is why people think you're inconsistent. You complained God is left out of scientific papers and then you say it doesn't have to be in papers, then searching for alternatives to creation is not evidence of ruling it out, then it is, then it isn't. I've actually quoted you doing it. Seriously, you should figure out what you're going to argue THEN post, not just say whatever you feel like at any given time. It's fun for us, but it doesn't make for a good discussion.

To be fair, I think Dempubliscents1 and/or Jocabia might be Christians, and they have done a lot to pretty much shred Bruarong's position throughout this thread. I know its a big one, but look through if you get a chance.

I know how you feel, though...

Yes, both of us are Christians.

And according to Bruarong following the evidence is close-minded. The way to be open-minded is to decide your position and then refuse to look for evidence that doesn't agree with that belief. Because "why would I look for evidence of something I believe didn't happen?" Forget the scientific method. The way to have a thorough theory is simply not to challenge it, in Bruarong's science at least.

True (as far as we know), but perhaps he contributed to greater reproduction by encouraging more stable communities (where everyone loved their neighbour), resulting in bigger families (initially) and then more research into ways to prevent death through sickness, etc., etc.

I do believe you are now arguing IN FAVOUR OF 'the selfish gene'?

I do believe you are now arguing IN FAVOUR OF 'the selfish gene'?

Isn't amazing how some people act like an argument is ridiculous unless it's convenient for them. When you said it, it was just silly. But as soon as rejecting them threatens a more important belief, magically, it's suddenly a rational argument.

I insist on the possibility of God being capable of both natural and supernatural actions--and always have. No backpedaling there.

Oh, I think I got you wrong. I thought you were calling my judgement unjust, when you were really describing the current situation as unjust. My apologies.

Well, if it makes you feel any better, I've noticed in my area that many scientists and engineers have been able to be pretty open about their religion and not suffer too badly.

Yes, both of us are Christians.

And according to Bruarong following the evidence is close-minded. The way to be open-minded is to decide your position and then refuse to look for evidence that doesn't agree with that belief. Because "why would I look for evidence of something I believe didn't happen?" Forget the scientific method. The way to have a thorough theory is simply not to challenge it, in Bruarong's science at least.

Yeah...

Well, I hate to sound schmaltzy, but thank you again, Jocabia, for being an example of an authentic religious person with a genuine regard for science. I'm sure we disagree on many, many things, but I have more respect for the possibilities of a religious mind after reading your stuff.

Yeah...

Well, I hate to sound schmaltzy, but thank you again, Jocabia, for being an example of an authentic religious person with a genuine regard for science. I'm sure we disagree on many, many things, but I have more respect for the possibilities of a religious mind after reading your stuff.

I work for an engineering firm where they give a prayer at every meeting. It's not as rare as some think. The problem it's the "reject the naturalist scientists" crowd that makes the most noise. They fail to acknowledge that the vast majority of scientists hold some form of religion to be true and Christianity and Judaism (both of which using the same creation items) being the most prevelant.

Edit: Oh, and thanks.

It feels like the original thread subject has been abandoned, so I'm not willing to read through the whole thing (mostly arguments I've heard before) but instead will offer my opinion on the original topic.

The second law of thermodynamics does nothing to disprove evolution. Want to know why?

Because the energy, the "Complexity" from evolution, doesn't come from nowhere. It comes from the sun. The sun is slowly burning out, and in a trillion years or so (though likely sooner) It will have burned out entirely. The energy from the sun started out in very complex bonds, energy is released from them through fusion. That energy makes it here, where it goes through a stage as life, or mechanical energy of another sort, (Like, perhaps, a machine that rolls rocks uphill...) If we don't find an exception to the second law, we will face a major crises in a few trillion years when we've converted almost all the matter to energy, which then turned to heat.

So because of the second law, energy proceeds in a sequence from fuel to work to heat. Life is merely a phase that energy goes through in it's march to heat.

My fault, perhaps, but our own personal 'subthread', the one with just me and you in it, is largely heading across an almost completely different area of discussion from almost every other one on here (which in turn is, as I previously said, nothing to do with the 2nd Law...). However, I'll try to deal fairly with you and not get to distracted from the TV (like I was this morning) which may have obscured my chain of thought.

But we don't know that the mutation that resulted in the drones not passing on their genes, but specifically enabling the queen to keep her reproductive capabilities was a simple one, or a simple few mutations.Bits of the queen-to-be's reproductive system get prodded by chemical messengers from within and without to initiated egg-production, condition said eggs, etc. SNPs in the appropriate sections can easily introduce modifications to the gene expression regulation, over-expressing, under-expressing or toggling expression of the transcription based upon the huge "parallel-equation" of chemical signals, metabolisers, enzymal interactions, etc, etc, etc.

If you're asking me to provide the exact and precise mutations that started the whole thing off, you're asking the wrong question. All it may take, however, is accumulated 'background' of a few SNPs that, when a 'final' SNP says "Oh, by the way, produce eggs regardless of having a father's DNA".
(BTW, I did specifically say "I don't know which direction the insect colonies came from", and by this I meant that there could have been a 'held over' capability for asexual reproduction, rather than a 'reacquired' one but did not take the time to explain what I meant, no reference how Dollo's law relates to this.)

For all we know, it could have required thousands of mutations, particularly if they would have to be point mutations.Maybe yes, maybe no. If the changes exist in non-coding/rarely-used/flexible/usually-of-little-matter DNA sequences, they can accumulate. Colonies that had not got the 'right' background level when one particular SNP and ended up... well... exploding the queen or starving her to death by "reproductive bulimia" or whatever the previously benign SNP complement forced the given creature to undergo when one of the many possible single 'switch-ons' that existed went 'ping' and brought the other stuff online beyond normal operational constraints...

Or maybe it was just one change. A change in a previously self-regulating enzyme that stopped the self-regulation (or started it if it wasn't prevously, or even made a perfectly normal component of some other process refold as a novel protein construct/RNA-strand/whatever). I suspect you have a decent, possibly even superior, knowledge of how the mechanisms of life can go out of kilter, if I understand your work with microorganisms correctly, and when it goes wrong-wrong-wrong, that'd be the end of the germline, but when it goes ok-ok-better and the germline survives... well, why not?


And we only have natural selection to account for all the mutations coming together for the amazing result. What we have is an explanation that doesn't seem to be supported by any empirical evidence, as far as I can see (which isn't all that far).No, I don't see that. It's not an amazing result. That something (that may individually look amazing) comes together is inevitable. But it's not a particular looks-amazing thing that is inevitable, but one of the many possible ones. Think of it as looking at the whole world's roulette players. Look at any single one of them and try to think howunlikely it is they win each and every time in their next ten bets on the wheel. But there'll be numerous ones out of all the whole global population of roullette players who will achive that. And I'm not just talking red/black decisions going right, there'll may well be some who go for (and get) odd/even * black/red choices, or an entire number-groups (either by the default 'on board' groupings, or spreading chips and losing some but winning others in a single spin) or even get an exact match on a single one of the 41 or 42 numbers on the wheel (I think it is, whether European or US variation)... Boy am I waffling. It's not an amazing result. It's the result of ignoring (because they didn't work, they dropped out, they bet away all their money/germline potential on the wrong random result) all the 'losers' in whatever competition we're discussing and being left with the ones that have won (have kept on winning, have not yet lost).

In short, it's not amazing, it's because the 'non-amazing' results have been prefiltered out of our viewing pleasure...

My point is not that evolutionary theory lacks explanations, but that it lacks empirical evidence, and details models about how such developments are possible.I completely disagree. Emperical evidence: Antibiotic-resistant bacteria, development of nylon-metabolisation, developed radiation-tolerance in organisms, observable adaptive changes (through breeding only, excluding gene-knockout experiments) in mice, fruit-flies, fish, etc, etc...
Detailed models: As discussed above... I won't go through it again.

[...] (I got this from reading an article by Michael J. Behe, and IDer) [...]I'm not going to justify that snake-oil merchant by arguing against him. Take that as a personal victory if you like, but please do your own thinking, don't rip off his delusions/shennanigans as 'proof' of your position. (Never mind that you've decided to take the argument over to abiogensis by invoking these particular opinions.)

If we humans are evolved beyond mere instinct, how did we do that? Through the evolutionary process?Yes. Proto-humans (or even proto-homonids/however far back it was when it arbitrarily 'started') used the wider capabilities of the developing brains towards increased society-formation rather than mere continuation of the 'pack-mentality' possess by the others and had a similar advantage over those who hadn't as a colony-producing queen had over a less regal contemporary...

There are distinct signs of evidence, through statistical analysis of genetic legacies, that there have been bottle-necks in human evolution. During one or more of the bottlenecks our own ancestors' enhanced feeling for society could have saved them when non-advantaged tribes failed to deal with some crisis or other.

Wouldn't that exclude or at least marginalise intelligence that tends to decrease reproducibility?Erm... no. It's not mere 'reproducability' that is important (although obviously without some degree of that nothing else matters) but 'survivability'/'thrivability'/'continuability'... It's hard to find the right term. A rarely expressed but common allelle in the genome that, when triggered by environmental or co-genetic factors (or by the same sort of esoteric trigger that makes some female fish in a population turn male when there's a lack of the latter) could allow a whole host of socially-viable behaviours to emerge that promote the continuation of the alleles in those that are breeding through the assistance of 'dead end' non-breeders like monks, nuns, others who are asexual or areproductive but share (however different the 'activation patterns' are) largely the same material.

OK, we do have homosexuals in modern communities, most of which do not pass on their genes. But we don't have close to 100% homosexuality, or we wouldn't for long.Umm... yeah... Because any society that did would die out whether the (near) 100% homosexuality were geneticly or memetically induced, or be usurped by those not possessing/subscribing to the factor. But we're rehashing old ground here.

But we do have human characteristics of love and self-sacrifice. Indeed, humans, and even animals, sacrifice their own lives to preserve those of genetically unrelated lives.Because those who would not survive due to the genetic or ideologically-induced (i.e. memetic) self-sacrifice of others don't stick around to promote societies similarly devoid of such influences, whereas those who survive due to others sacrifice go on. It's the filtering-out of all anti-promoting behavours and finding the rest go on, just like the filtering out of dead-end morphologies or the filtering out of societies that have unsustainable corruption or any other filtering-out that might happen.

Some people have suggested that such calls to 'love your neighbour as yourself' runs contrary to the inclusive fitess of the genes, even though it promotes social cooperation and peace of mind.It depends. If it promotes those with the same (if not fully-developed) tendencies towards 'peace and love' then it's a viable meme. If it breaks down the 'background suspicions' that protect the 'norms' form the 'cheaters' then it's not going to survive (in the same form) for any length of time.

I've no idea what you're getting at with this argument. Maybe you're arguing along the same lines as one might argue against the One Child policy in china without reference to how many couples there are producing just one child (i.e. not sustainable, but it's not 'death in one generation') or... darn.. more waffle, I won't go through all the anologies.

''If one believes that humans are designed to be loving organisms, then it is a reasonable hypothesis that behaviour which is generous towards others might actually increase fitness, not because it increases social status and therefore inproves access to resources, but because even if resources are relinquished, it may imporve utilization efficiency or result in psychoneurological states that promote immunity, learning, vitality or other aspects of well-being. There are all testable hypotheses that do not require a commitment to supernatural agency before one investigates them, much less conceives of them.''
J. P. Schloss

This chap seems to be saying that if evolutionary theory is allowed to have explanations without empirical evidence, then intelligent design is certainly allowed to pursue their own explanations, particularly ones that can be tested by the empirical method.Evolutionary theory does not have "explanations without emperical evidence". Intelligent Design, however... well, you know the majority opinion on that.

I'm sorry, but I've a feeling I'm not tuning in on your wavelength at all. I cannot grasp your arguments, what you are 'for' and 'against' half the time, and the rest is heavily dosed with misunderstandings or unthinking loyalties... And that isn't meant to be as corrosive as it might sound.

The only way I can conceive of to prove "God" is if you knew everything there was to know about the universe and something still remained unexplained. Only then, in the absence of other natural phenomena, could you even begin to suggest the existence of some kind of "other" being.



Yes, science is less apt to provide a definintive answer on certain topics. But what science should not do is let religious fundamentalist/fanatics pick and choose areas of science that they can spin into evidence for their position, and then try and refute their misuse of scientific principles.

Way back when, science and philosophy were seen as two parts of the same discipline (effectively gaining knowledge about reality was seen as one discipline). Science needs to return more or less to its roots in that respect. Perhaps science can't tell us exactly what happens or why something happens in some respect. But that doesn't mean that science shouldn't let its hypotheses known.


God is a poor substitute for an explanation when a perfectly rational and mundane explanation will suffice. Science should let people where it is appropriate to assert "God" as a explanatory device. Now I admit this is a rather cold and analytical (devoid of faith) way of speaking about "God," but it bears doing so at times. In a vacuum of objectivity God could be the explanation for everything. Q: Why do flowers grow? A: Because God makes them grow.

It is exactly this type of reasoning/methodology/belief system which needs to get shot down.


Edit: To those of you who suggest natural selection can't ultimately account for the creation of complex intelligent life, then I suggest to you that you need to go back and look at some statistics. The universe is a vast place, and to suppose that earth is the only environment of its kind in the entire universe is just utter, utter rubbish. So earth just so happens to be that rare instance where humans sprung up from the primordial soup. Science has already shown expirementally how amino chains can be built out of "primordial soup" conditions. Humans could have just as easily developed on a class M planet in the Andromeda galaxy (or some other galaxy), but we didn't. Deal with it.

NT

I don't recall saying that the radio dating techniques were out. I do recall saying that the technique was based on assumptions (within the method) and that it is unwise to prove an old earth using assumptions.

Origin of species?

My faith has it that God is the origin of species, regardless of whether he used natural forces or supernatural ones, i.e. that he created, either directly or indirectly. Science cannot prove either way. Many people conclude that the species came about through natural means, but I have concluded that they have not. Empirical science does not come down on either side of the argument. It can show us microevolution, but not macroevolution. Thus it is only a clash of conclusions, not a clash of science versus faith. Therefore, I think that my faith is not at odds with science. It is at odds with popular opinion, perhaps, but not science.
This is a very old post, but I have to rebutt this.

Macroevolution has in fact been observed. Read Wikipedia sometime (http://en.wikipedia.org/wiki/Evolution):

http://en.wikipedia.org/wiki/Evolution#Hawthorn_fly

A clear case of evolution as an ongoing, observable fact involves the hawthorn fly, Rhagoletis pomonella (http://en.wikipedia.org/wiki/Rhagoletis_pomonella). Different populations of hawthorn fly feed on different fruits. A new population spontaneously emerged in North America in the 19th century some time after apples, a non-native species, were introduced. The apple feeding population normally feeds only on apples and not on the historically preferred fruit of hawthorns (http://en.wikipedia.org/wiki/Crataegus). Likewise the current hawthorn feeding population does not normally feed on apples. A current area of scientific research is the investigation of whether or not the apple feeding race may further evolve into a new species.

Some evidence, such as the fact that six out of thirteen alozyme loci are different, that hawthorn flies mature later in the season and take longer to mature than apple flies; and that there is little evidence of interbreeding (researchers have documented a 4-6% hybridization rate) suggests that this is indeed occurring. The emergence of the new hawthorn fly is an example of macroevolution in process.
It would be wise also to read up on the misunderstandings about modern evolutionary biology (http://en.wikipedia.org/wiki/Evolution#Misunderstandings_about_modern_evolutionary_biology). ;)

So you think 'basic' life does not require complex enzymatic processes? That would be even more incredible.

Not really. At its most basic, many of the complex enzymatic processes now used would be unnecessary. Most of the complex proceses within our own cells are redundant - and we can survive without them. The life acheived is not as robust, but it is alive. Take that to the level of a single-celled organism. How much of the processes can we knock out before the cell ceases to live?

Apparently not. I use the Qiagen kit. 94 degrees. 3 min. I always get results that give me the approximate initial number of RNA molecules, allowing me to determine relative levels of gene expression.

So, I thought that, just maybe, you weren't making things up - that you actually were using a form of RT I've never heard of, so I looked up the Qiagen Reverse Transcriptase kit. Strangely enough, there is no step at 94 degrees listed, at least not until *after* reverse transcription has been carried out at 37 degrees and you wish to deactivate your RT.

This makes quite a bit of sense, considering that nearly all proteins will become denatured and fail to renature when taken to such high temperatures. The only reason that PCR works with such high termperatures is the fact that Taq DNA Polymerase is resistant to them.

In cancerous cells, there is usually a single mutation, which removes the control that prevents uncontrolled cell division.

Actually, generally, it is at least five.

This is hardly a fair comparison to the primitive cell considered in abiogenesis. In fact, quite irrelevant. I never said that all of the controls in a modern cell are necessary in order for it to survive.

Yes, actually, you did. You stated that the controls are absolutely necessary for life. You can go back and look at your own quotes if you would like.

The concept of "self-replicating RNA" is a complete product of fantasy, and actually this kind of RNA has not been produced in any experiment.

On further examination, it seems that RNA sequences have been found that catalyze replication of other sequences, leading to speculation on the possibility of RNA sequences that might be able to catalyze their own replication. Of course, to say that it is 'complete fantasy' is a bit silly. If we know that RNA can catalyze the replication of RNA, then a self-replicating RNA isn't a huge logical jump.

It's an insult unless you can provide a good reason for it.

And I have provided many, time and time again - every time I have to correct you on basic scientific principles. Others have done the same - time and time again.

Laws actually don't make predictions. Humans do. And I think that if you take into consideration the implications of SLT, and the other available forces and conditions that were most likely present at abiogenesis, I think any intelligent human can make the prediction that abiogenesis would not have occurred.

Oh wait, you're backpedaling. You said that the SLT2 directly predicted against not only abiogenesis, but evolutionary theory. Are you retracting that now? You seem to have added in other factors - not that you or I are aware of all of the factors that may or many not have been present.

Are you talking about science or people within science?

Both, really. By adhering to the scientific method, the people within science are bound by science.

Because there are plenty of people who do not allow creation as an alternative, despite having no evidence against it.

From a scientific point of view, such an alternative is irrelevant, as it cannot be investigated by science. It would be no different than complaining that a chemist didn't allow for the "alternative" theory that God personally combined the chemicals in the vial into a new one. Personal beliefs and scientific theories are not the same. The presence of God is always allowed for - simply outside of science.

But in our discussion of abiogenesis, it has always meant the formation of life in the absence of supernatural means. Don't go changing the parameters now.

Nothing in any of our discussions has ever meant anything in the absence of supernatural means. This is what you fail to understand. Because science is bound by the natural, it can only investigate natural explanations for things. This does not mean that anything happened "in the absence of supernatural means". However, even if confronted with supernatural occurrences, science would see whatever happened as having happened naturally, and would interpret the natural world in that light.

Not the only reason, and perhaps not the major one, but one of them, sure.

So, if it weren't for the fact that you might lose your job, you would throw the scientific method out the window and include God in your science?

No. There is no reason to approach science as if God does not exist. It simply is not necessary, despite your repetitive claims.

If you do not inject God into the science, then you are performing science as if God does not exist - plain and simple. It doesn't mean that you have to believe that God does not exist, because your beliefs are not part of your science.

Put it this way: I perform experiments in the lab as if my dog does not exist. My dog is not involved in my experiments, so they are carried out as if he does not exist. They would be exactly the same whether I had a dog or not.

No, there is no reason to inject the supernatural in it either. The existence of God is never questioned in my science, since it is not part of the experiment.

If you do not question God in your science, then your science would be the same whether God existed or not. Thus, you perform science as if God does not exist.

I see that I should not have put the word 'only' in there. Rather, I should have said that the data can 'only be reasonable interpreted as consistent with a creator'.

You said the exact same thing, with words in a different order. There is no data that can only be reasonably interpreted as consistent with any explanation, as one must always continue to question and might find a better explanation as time goes on.

And someone who believes in God should be able to allow that God may have done something that is consistent with his knowledge of God.

Personally? Yes, of course. In science? Absolutely not. Doing such would necessitate making an assumption, within the science, that God exists. It would require injecting God into science.

One can postulate the presence of a designer, and then look to see if the data fits with that postulation, without necessarily assuming that there is a designer,

No, you can't. You must assume that something which could have done the designing exists if you are to investigate the possibility of a designer. No data can point to the presence of a design without the a priori assumption of a being that could be the designer.

But even if I did assume that He created, I still think that I am capable of discovering truth about the material world through empirical methodology.

No, you aren't - not if you are investigating anything about what you think was created. Once you make that assumption - a completely untestable one - all data you get will be interpreted in light of the original assumption. If your assumption is wrong, your conclusions will be wrong - and you will never know it, because you cannot test your assumption.

I understand that. In the context of what I was saying, the existence of successful species indicates that their ancestors were successful in passing on their genes. So that any trait in humans that decreases the chances of passing on genes would have been selected against.

Indeed. Any genetic trait that caused such a thing would, over time, be selected against. That has little to nothing to do with your suggestion that nuns and priests would be examples of evolutionary theory failing, however. Are you suggesting that there is a "priest" gene?

Which is what I said. I suggested that any DNA over 1 kb (just a guess) in length might cause a measureable disadvantage, requiring extra energy during DNA replication and cell division.

It would seem to me that any measurable disadvantage would have to be a significant percentage of the total genome. In other words, a creature with an already large genome would tolerate more "excess DNA" than a creature with a smaller genome. Of course, at least in species with chromosomal DNA, if that excess DNA were often passed on with a beneficial trait, the two could cancel each other out.

Yet another explanation that has either no empirical evidence for, or very little.

There is all sorts of empirical evidence. You simply don't like it.

So you need to invent an explanation that adequatly explains how the genomes are strinking now, but have generally been growing otherwise. And then you could find some empirical evidence while you are at it. Good luck.

I don't need any such thing. You are the one trying to disprove a theory. Thus, it is *you* who must demonstrate that evolutionary processes would always result in shrinking genomes. If you cannot demonstrate this, then you have not shown the theory to be incorrect, and it will still stand as a valid theory, as there is no empirical evidence to disprove it.

'Everyone and their brother' means you, I suppose.

Me, Jocabia, Grave, St Curie, Bak, Wes - and that's just in this thread. I've seen numerous others have to correct you in numerous other threads.

The only way I can conceive of to prove "God" is if you knew everything there was to know about the universe and something still remained unexplained. Only then, in the absence of other natural phenomena, could you even begin to suggest the existence of some kind of "other" being.

Ah, but how would you know that you knew "everything about the universe"? That is exactly the issue. The scientific method essentially assumes that we will never know everything, that we must always keep questioning to get closer and closer to the truth. Even if we were able to know everything about the universe, we still wouldn't know that we knew everything, and would still keep questioning...

God is a poor substitute for an explanation when a perfectly rational and mundane explanation will suffice. Science should let people where it is appropriate to assert "God" as a explanatory device.

I'm not exactly sure what you are saying here, but it sounds like you are arguing in favor of the "God of the gaps" ideas. Science will "let" people assert God whenever and however they want to. It is science itself that cannot assert any such thing, as science can neither assume the existence nor the nonexistence of God.

Actually, I had a cool thought. One of the laws of thermodynamics is something like "Choas cannot be turned into order without the application of energy" or something to that effect. Now, if the commonly accepted theory of the "big-bang" is true, than there was chaos. Now, without applied energy, chaos cannot be turned into order. Therefore something had to apply energy to turn the chaos into order. Now, nothing that we know, at least right now, could do that excpet some sort of supreme being. I'm probably wrong, so, whatever.

Another of my theories is that God guided evolution into it's current state. Example: Why are we just close enough to the sun, with just the right atmosphere, and why are we the only intelligent species, with nothing approaching us except perhaps dolphins and monkeys, which is a result of natural evolution, because God abondened us about 500,000 years ago to evolve on our own.

Also, for people who point to no Earthly evidence, if a Supreme Being didn't want to know he existed, we wouldn't.

Actually, I had a cool thought. One of the laws of thermodynamics is something like "Choas cannot be turned into order without the application of energy" or something to that effect.

No, not really. The law you are thinking of is the 2nd law of thermodynamics, which states that any process must either increase the overall amount of entropy or leave it the same. From that, we know that a spontaneous process will involve a decrease in entropy, but the energy released from such a process can fuel a non-spontaneous reaction, leading to a decrease in entropy in certain places.

Entropy and order are not equivalent, however. There are cases in which increasing order actually increases entropy.

Why are we just close enough to the sun,Because if we were at the wrong distance from the sun, we ouldn't be around (or we would instead be creatures for whom this other distance from the sun is 'right', and this distance from the sun is 'wrong').

with just the right atmosphere,Ditto. The atmosphere we have now is the atmosphere that the creatures we are now are used to, can deal with, think of as normal. But it hasn't always been that way. Of course, none of 'us' were around back in the day when that deadly poisonous gas 'oxygen' was being liberated into the atmosphere by early organisms, and a few hardy types started to develop the ability to survive within, absorb and finally make use of this nasty horrible reactive gas.

and why are we the only intelligent species,If we weren't an intelligent species, we wouldn't be asking the question. If we weren't the only intelligent species, we wouldnt be asking the question. As it is, you still caveat...

with nothing approaching us except perhaps dolphins and monkeys,Well, with all respect, monkeys aren't particularly outstandingly intelligent, given a provably common ancestry means that we 'all had it in us'. I find it fascinating that dolphins/whales/etc have complex societies. I find avian intelligences quite interesting too. I absolutely love the idea that many cephelapods have extraordinary intelligences.

(Did you know that octopusses are on many countries' lists of "animals that cannot be operated on without anaesthetic", that they have been known to sneak out of their aquaria to feed on creatures in neighbouring ones then sneak back, at night, to climb on board fishing vessels and open the hatches to fish holds, release things into circulating currents and catch them again 'in play' and in experiments where they have to remove various kinds of packaging to open containers and get a 'food reward', they wrap the whole thing back up again for the exoerimentors, who they seem to recognise by sight....)


which is a result of natural evolution,Personally, I belive the whole gamut of life on earth, 'us' and 'them', are all a natural result.

because God abondened us about 500,000 years ago to evolve on our own.Fair enough, as a belief. Sparse on emperical evidence but as long as you don't reject known facts about that period of time when shoehorning your deity in I'm Ok with it....

Also, for people who point to no Earthly evidence, if a Supreme Being didn't want to know he existed, we wouldn't.I find it strange that if He exists he has waved his hands in front of a few delerious guys in a desert said "Yoohoo! Do you like my burning bush?" and then gone away.

In my mind, the perfect Deity would have set the whole universe up from the Big Bang, ensured the ripples in the early expansion were set to make the world as He wanted it (assuming that this world was the one He was setting the Universe up for) and then left it alone so as to leave no footprint. I suspect that any footprints we do see (even in the COBE data that we see of the CBR) are purely imaginary and that He is much more subtle in his effects, should He exist. Anything less standoffish than that would reveal failings in His methodology, especially the whole "having to fake the history of the Earth prior to 6000 years ago" style of thing (a minority view, but one that exists).

(Of course, I could be wrong, I mean... He is supposedly ineffable, inscrutable, works in mysterious ways (probably doesn't pay income tax, for a start) but that kind of being doesn't have the 'intellectual purity' to it that I intrinsically feel that we should have been honoured by... Is it a bad thing to demand that of my God? Well, never mind, as I also work on the assumption that God knows how I am and knows that I'm not going to blindly believe in Him...)

Why are we just close enough to the sun, with just the right atmosphere, and why are we the only intelligent species, with nothing approaching us except perhaps dolphins and monkeys, which is a result of natural evolution, because God abondened us about 500,000 years ago to evolve on our own.
You start off with an interrogatory tone of voice, but then end with an explanatory one. It's very jarring. I don't know if this is a question or a statement. But no matter.

Your question-statement-thing hinges on the assumption that a supernatural being built the world just for us, or in other words, that we were supposed to be here.

Life springs up in the universe where it happens to be suitable, and Earth was one of those places. Once it was here, it evolved to suit its changing surroundings over a long period of time, and as of modern times this has resulted in us.

You seem to be trying to wrap your head around that, but with a religious bias; thus, you're failing to take it all into consideration. You should do your best to discard that bias, for the sake of consideration, so you can see that we aren't necessarily supposed to be, whether here, over there, or anywhere; and that if this place weren't suitable for us, then either we would be here in a form that is suited to this place, or we would be somewhere else.

thermodynamics is not the only way to disprove the existance of god using physics. electron diffraction is a quantum phenomina that causes electrons (a particle) to act as a wave, this is becuase the exact location, velocity, and spin of the electron are not determined. it has been shown in many repeated and credible experiments that if any of the properties of the electron are known then diffraction fails to occur.

thus is god is all knowing, then it would know the properties of the electron and diffraction would not occur. since diffraction does occur then it can be reasonably concluded that god is at least not all knowing.

supernatural does not in any way comply with nature, or "science". this quote therefor is not an arguement at all. he who said it repent! lol

Another of my theories is that God guided evolution into it's current state. Example: Why are we just close enough to the sun, with just the right atmosphereIf the earth wasn't in a suitable place, and there wasn't a suitable atmosphere, we wouldn't be here. We can only be at a place that is suitable for our kind of life.
Wherever we might have been, would have to have been suitable. Whether we would be carbon based life forms on a aqueous planet, or selfreplicating magnetic energy patterns in a sun's magnetosphere.

and why are we the only intelligent speciesIf we weren't an intelligent species, we wouldn't be wondering this. So that's one part.
Why just the one? Well, one has to be first, if you assume intelligence is a develloped trait.
And besides we do a good job of killing everything in our path, maybe 50000 years ago there were other intelligent species.

Also, for people who point to no Earthly evidence, if a Supreme Being didn't want to know he existed, we wouldn't.We don't know, though. Some people believe one exists, some don't.
And if a surpreme being created a perfect universe, it would have to be indistinguishable from one he did not take part in. Because if he has to hack out bugs in the universal code, it isn't perfect.
Or to put it another way, if God creates a perfect universe that requires him to be involved in it, I can imagine a more perfect universe, namely one that doesn't require him to be involved in it. Up to the point that it must seem like he did not create it.
Obvious telltale signs of divinity are flaws in the design.

Yes and if that was what you said, I might buy that. And, in science, gaps are not evidence of an inadequate explanation. If it's a bad explanation we disprove it. No one has been able to do that with evolution.

You can't disprove any explanation without adequate evidence. You can't actually disprove fairies. The way in through which we can reject the notion of fairies is by pointing out the inconsistencies in the explanation for fairies, i.e. the gaps, not to mention that lack of empirical evidence.



That's not the point. You plainly said you won't look and you think it shouldn't be funded. You've also repeatedly stated the only people looking for such explanations are naturalists. Stop pretending to be open-minded and the "I don't assume God interfered any specific place" when you are unwilling to consider any other explanation than the one you've decided to be true.


I never said that sort of research should not be funded. Neither have I said that the only people looking for such explanations are naturalists. Neither am I pretending. And, yes, I am willing to consider alternative explanations, although not necessarily willing to change from my current area of research in order to explore them.


Can you introduce me to anyone who ruled out the possiblity of creation? Most people are simply willing to keep looking for evidence and see where it leads. You consider yourself open-minded for refusing to look for evidence that doesn't match your beliefs and them close-minded for continuing to look for evidence on which to base their beliefs. You have a strange definition of open-minded and close-minded.


Anyone who is a committed naturalist would rule out the possibility of creation. Once again, I never said that I would be unwilling to look at evidence, and see where it leads, regardless of whether it matched my beliefs. Could you have gotten my position any more wrong?
So go ahead, accuse me of lying once again.



Meanwhile, you keep saying you aren't accusing the scientists looking at these theories of being naturalists every time we press you on it and then a minute later you're calling them naturalists. It's pretty funny. I actually show your posts around my office for giggles and this is an office where they say a prayer at every company meeting. I guess my cohorts can tell the difference between beliefs and science.

Looks like you seriously haven't grown up (yet) if you carry on with that sort of behaviour.

My fault, perhaps, but our own personal 'subthread', the one with just me and you in it, is largely heading across an almost completely different area of discussion from almost every other one on here (which in turn is, as I previously said, nothing to do with the 2nd Law...). However, I'll try to deal fairly with you and not get to distracted from the TV (like I was this morning) which may have obscured my chain of thought.

Fair enough.


Bits of the queen-to-be's reproductive system get prodded by chemical messengers from within and without to initiated egg-production, condition said eggs, etc. SNPs in the appropriate sections can easily introduce modifications to the gene expression regulation, over-expressing, under-expressing or toggling expression of the transcription based upon the huge "parallel-equation" of chemical signals, metabolisers, enzymal interactions, etc, etc, etc.


I get the feeling that you are not that familiar with biology at a practical level with you say things like '...can easily introduce modifications...' when most biologists would agree that there is nothing easy about it. They might even admit that it is unlikely, given the number of mutations that would have an unfavourable result compared to those that might actually be of benefit.



If you're asking me to provide the exact and precise mutations that started the whole thing off, you're asking the wrong question. All it may take, however, is accumulated 'background' of a few SNPs that, when a 'final' SNP says "Oh, by the way, produce eggs regardless of having a father's DNA".


I wouldn't be so unfair as to ask you for exact and precise mutations. However, perhaps it would not be unreasonable for some expert in that area to come up with a model. None have, as far as I have read. The reason might be that it is far too complicated, or that it is far too unlikely, and therefore would not stand up to the criticism.


Maybe yes, maybe no. If the changes exist in non-coding/rarely-used/flexible/usually-of-little-matter DNA sequences, they can accumulate. Colonies that had not got the 'right' background level when one particular SNP and ended up... well... exploding the queen or starving her to death by "reproductive bulimia" or whatever the previously benign SNP complement forced the given creature to undergo when one of the many possible single 'switch-ons' that existed went 'ping' and brought the other stuff online beyond normal operational constraints...


The problem with the postulation that inconsequential (neutral) mutations can eventually accumulate to a point where a heavily mutated sequence can code for a e.g. a protein that confers an advantage is riddled with logistical problems. It needs to have the stop and start condons, the ribosome binding sequence, a promotor that is not too strong or too weak. The gene product needs to have a secondary, tertiary, and sometimes quaternary structure, the folding of which is usually assisted by another protein (which just happens to be waiting with the right recognition sites), and then this new protein needs to be targeted to the right location, and then it needs to perform a function that does not harm the organism. In eukaryotes, it needs to be in the right tissue, expressed at the right time. I don't think anyone would ever call that 'easy'.


Or maybe it was just one change. A change in a previously self-regulating enzyme that stopped the self-regulation (or started it if it wasn't prevously, or even made a perfectly normal component of some other process refold as a novel protein construct/RNA-strand/whatever). I suspect you have a decent, possibly even superior, knowledge of how the mechanisms of life can go out of kilter, if I understand your work with microorganisms correctly, and when it goes wrong-wrong-wrong, that'd be the end of the germline, but when it goes ok-ok-better and the germline survives... well, why not?


If it was a single change, it would have to be a loss of information, not a gain (e.g. a point mutation can knock-out a transporter gene, preventing the import of a potentially fatal molecule, like an antibiotic). This is possible, of course, but it cannot be always so. At some point, there must be a gain of information to account for genetic changes, according to the theory of evolution.

I do not assume that I have a superior knowledge of biology, and even if I did, it doesn't mean that my arguments are superior.


No, I don't see that. It's not an amazing result. That something (that may individually look amazing) comes together is inevitable. But it's not a particular looks-amazing thing that is inevitable, but one of the many possible ones. Think of it as looking at the whole world's roulette players. Look at any single one of them and try to think howunlikely it is they win each and every time in their next ten bets on the wheel. But there'll be numerous ones out of all the whole global population of roullette players who will achive that. And I'm not just talking red/black decisions going right, there'll may well be some who go for (and get) odd/even * black/red choices, or an entire number-groups (either by the default 'on board' groupings, or spreading chips and losing some but winning others in a single spin) or even get an exact match on a single one of the 41 or 42 numbers on the wheel (I think it is, whether European or US variation)... Boy am I waffling. It's not an amazing result. It's the result of ignoring (because they didn't work, they dropped out, they bet away all their money/germline potential on the wrong random result) all the 'losers' in whatever competition we're discussing and being left with the ones that have won (have kept on winning, have not yet lost).

In short, it's not amazing, it's because the 'non-amazing' results have been prefiltered out of our viewing pleasure...


It would be amazing if you or I won the lottery five times in a row. It isn't amazing that someone actually won the lottery, since there is almost always going to be a winner. That's no comparison.



I completely disagree. Emperical evidence: Antibiotic-resistant bacteria, development of nylon-metabolisation, developed radiation-tolerance in organisms, observable adaptive changes (through breeding only, excluding gene-knockout experiments) in mice, fruit-flies, fish, etc, etc...
Detailed models: As discussed above... I won't go through it again.


All these examples are facts that we have observed in science. But does something like adaptation provide evidence for evolutionary theory? Not necessarily. No one argues that bacteria are capable of developing resistance, but whether the same mechanism argues for the evolutionary theory is a different matter. I do not question the things that we can observe, repeat, etc, but I don't consider this empirical evidence for evolutionary theory.


I'm not going to justify that snake-oil merchant by arguing against him. Take that as a personal victory if you like, but please do your own thinking, don't rip off his delusions/shennanigans as 'proof' of your position. (Never mind that you've decided to take the argument over to abiogensis by invoking these particular opinions.)

I'm not looking for personal victories, and even if I was, I couldn't possibly claim that as one.
But out of interest, why do you think he is a snake-oil merchant? Do you think he has been dishonest, or disloyal? Surely you don't think of him like that simply because you disagree with him? You wouldn't make a very nice enemy, in that case.


Yes. Proto-humans (or even proto-homonids/however far back it was when it arbitrarily 'started') used the wider capabilities of the developing brains towards increased society-formation rather than mere continuation of the 'pack-mentality' possess by the others and had a similar advantage over those who hadn't as a colony-producing queen had over a less regal contemporary...


The problem with thinking that human intelligence 'floated free' from natural selection is that at some point, the detachment from natural selection implies that the evolution of intelligence is effectively halted, for the general population.


Erm... no. It's not mere 'reproducability' that is important (although obviously without some degree of that nothing else matters) but 'survivability'/'thrivability'/'continuability'... It's hard to find the right term. A rarely expressed but common allelle in the genome that, when triggered by environmental or co-genetic factors (or by the same sort of esoteric trigger that makes some female fish in a population turn male when there's a lack of the latter) could allow a whole host of socially-viable behaviours to emerge that promote the continuation of the alleles in those that are breeding through the assistance of 'dead end' non-breeders like monks, nuns, others who are asexual or areproductive but share (however different the 'activation patterns' are) largely the same material.


In the end, though, it is only reproduction that counts. No matter how brave and good a fighter you are, if you do not have kids, all your qualities will die with you.




Evolutionary theory does not have "explanations without emperical evidence". Intelligent Design, however... well, you know the majority opinion on that.


I suggest both theories have explanations without empirical evidence, at least in some cases. I'm obviously not a part of the majority, but then again, that isn't that important to me.


I'm sorry, but I've a feeling I'm not tuning in on your wavelength at all. I cannot grasp your arguments, what you are 'for' and 'against' half the time, and the rest is heavily dosed with misunderstandings or unthinking loyalties... And that isn't meant to be as corrosive as it might sound.

I'm not as good a communicator as I would like to be, so it is possible that many of my points are lost in that. And I think it OK for us to agree to disagree, particularly as we are on opposite sides of the debate. The point of this debate (for me) is not to win, not to convert anyone to my way of thinking, but to get better as expressing myself, and my point of view, and to learn more about the objections that people have to my points of view. Sometimes I do have to criticise evolutionary theory in order to do this, but my main objective here is not to criticise the theory (believe it or not).

This is a very old post, but I have to rebutt this.

Macroevolution has in fact been observed. Read Wikipedia sometime (http://en.wikipedia.org/wiki/Evolution):

http://en.wikipedia.org/wiki/Evolution#Hawthorn_fly

A clear case of evolution as an ongoing, observable fact involves the hawthorn fly, Rhagoletis pomonella. Different populations of hawthorn fly feed on different fruits. A new population spontaneously emerged in North America in the 19th century some time after apples, a non-native species, were introduced. The apple feeding population normally feeds only on apples and not on the historically preferred fruit of hawthorns. Likewise the current hawthorn feeding population does not normally feed on apples. A current area of scientific research is the investigation of whether or not the apple feeding race may further evolve into a new species.


Speciation is not necessarily evidence for macroevolution, since it can also be quite neatly explained in terms of creation of a basic type, which has diverged over time and through reproductive isolation into e.g., non-breeding communities. In fact, what we know of speciation would fit better with this concept, since we can see this happening. On the other hand, the idea that speciation provides evidence for macroevolution is like saying churches are evidence for the existence of God.


Some evidence, such as the fact that six out of thirteen alozyme loci are different, that hawthorn flies mature later in the season and take longer to mature than apple flies; and that there is little evidence of interbreeding (researchers have documented a 4-6% hybridization rate) suggests that this is indeed occurring. The emergence of the new hawthorn fly is an example of macroevolution in process.

Note that the writer does not say that this is an example of macroevolution, but of macroevolution in process. What he means is that this observation is consistent with macroevolution, but does not tell us whether macroevolution is true, just as the presence of churches are consistent with the existence of God, but do not tell us that He exists.

Another point that the writer has not addressed is that the term 'macroevolution' has not been specifically defined, and there are several current definitions of the term 'speciation'.


It would be wise also to read up on the misunderstandings about modern evolutionary biology (http://en.wikipedia.org/wiki/Evolution#Misunderstandings_about_modern_evolutionary_biology). ;)
[/QUOTE]

Indeed.

If it was a single change, it would have to be a loss of information, not a gain (e.g. a point mutation can knock-out a transporter gene, preventing the import of a potentially fatal molecule, like an antibiotic). Some point mutation constitute neither a loss nor gain, but simply a change in information.
And of course 'information' is a laden terms. More bases in the DNA doesn't mean it has more usefull information. We have less genes that a lot of seemingly simpler organisms. Genetics is only part of the story.
Of course that doesn't change the question of how changes devellop.

All these examples are facts that we have observed in science. But does something like adaptation provide evidence for evolutionary theory?If an actual new trait has develloped (rather than the bacteria that already had it being selected), then I'd yes it does.
The observation of beneficial genetic changes gives evidence that it's a mechanism that does in fact occur. Moreso it occurs under the circumstances evolution theory predicts, selective pressure (slowly poisoning the environment of the bacteria, giving those who cope better the advantage).

The problem with thinking that human intelligence 'floated free' from natural selection is that at some point, the detachment from natural selection implies that the evolution of intelligence is effectively halted, for the general population.Reality TV provides ample evidence to that point ;)
Selection needn't be natural per se though. Or you can be more liberal with what you call natural. If intelligence gets you a better job and a better mate than the competition, there's still positive selection. Whether you want to call it natural or not.

In the end, though, it is only reproduction that counts. No matter how brave and good a fighter you are, if you do not have kids, all your qualities will die with you.Not entirely true. If you have siblings, they share (for most species on our planet) abotu 50% of your traits. If you die childless, but in doing so sufficiently increase their chances of survival/reproduction, your traits also likely survive.
Which can account for altruistic behaviour in nature.
e.g. By serving their queen, bees can ensure the next generation of bees will be much like them. 50% of their genes will be passed on, the same as if they would reproduce themselves, but a hive is much more resilient than a single bee, and so the probability of that 50% being passed on is much greater.

Speciation is not necessarily evidence for macroevolution, since it can also be quite neatly explained in terms of creation of a basic type, which has diverged over time and through reproductive isolation into e.g., non-breeding communities.But they'd still be the same species in the latter case wouldn't they? Something has to change on the phenotype level, which has to be preceeded by some change at the genetic level if it is to be a heriditary trait.

On the other hand, the idea that speciation provides evidence for macroevolution is like saying churches are evidence for the existence of God.The existence of god does not predict churches, looking for churches and not findign them would not dicredit the theory of godly existence.
However not finding speciation, would discredit the theory of evolution. Therefor it provides eveidence; a possible falsification has failed.

Speciation is not necessarily evidence for macroevolution, since it can also be quite neatly explained in terms of creation of a basic type, which has diverged over time and through reproductive isolation into e.g., non-breeding communities. In fact, what we know of speciation would fit better with this concept, since we can see this happening. On the other hand, the idea that speciation provides evidence for macroevolution is like saying churches are evidence for the existence of God.

What is speciation if not what skeptics call macroevolution?

http://www.talkorigins.org/faqs/macroevolution.html

In evolutionary biology today, macroevolution is used to refer to any evolutionary change at or above the level of species. It means the splitting of a species into two (speciation, or cladogenesis, from the Greek meaning "the origin of a branch") or the change of a species over time into another (anagenesis, not nowadays generally used). Any changes that occur at higher levels, such as the evolution of new families, phyla or genera, is also therefore macroevolution, but the term is not restricted to the origin of those higher taxa.

Microevolution refers to any evolutionary change below the level of species, and refers to changes in the frequency within a population or a species of its alleles (alternative genes) and their effects on the form, or phenotype, of organisms that make up that population or species.

Another way to state the difference is that macroevolution is between-species evolution of genes and microevolution is within-species evolution of genes.

Speciation IS macroevolution. Hmmmm... our resident scientist marks yet ANOTHER major misunderstanding of a basic concept.

Please, explain what macroevolution is if speciation does not count, my friend?

You can't disprove any explanation without adequate evidence. You can't actually disprove fairies. The way in through which we can reject the notion of fairies is by pointing out the inconsistencies in the explanation for fairies, i.e. the gaps, not to mention that lack of empirical evidence.

Evolution doesn't lack emperical evidence. We could still use more, but that is always true. There is more evidence for evolution than there is for the 2nd Law of Thermodynamics and you seem to be quite comfortable with that theory.



I never said that sort of research should not be funded. Neither have I said that the only people looking for such explanations are naturalists. Neither am I pretending. And, yes, I am willing to consider alternative explanations, although not necessarily willing to change from my current area of research in order to explore them.

Dude, I'm tired of quoting you. We all saw you say these things. At this point, do you really think you're fooling anyone? I quoted you stating that you are unwilling to explore the evolutionary tree because you believe it doesn't exist. You can try to take that out of context, but at the time we weren't talking about you actually changing your field. You clearly stated that you don't think it's worth pursuing because it doens't follow your beliefs. And you very much implied it when you said you'd let the naturalist continue to explore evolution.


Anyone who is a committed naturalist would rule out the possibility of creation. Once again, I never said that I would be unwilling to look at evidence, and see where it leads, regardless of whether it matched my beliefs. Could you have gotten my position any more wrong?
So go ahead, accuse me of lying once again.

Yes, in fact, you did say that. You said you were unwilling to even consider that evidence might exist and thus would avoid looking for it. I don't have to accuse you of anything. I quoted you. You can keep saying it's a problem of our understanding, but as of yet I haven't seen a remotely adequate explanation of your hangup with naturalism (basically anyone who doesn't refuse to do proper science is a naturalist with you, except you won't actually say that outright, but just imply it in a dozen or so posts). I haven't seen you adequately explain the other inconsistencies in your posts. You've accused Dem of being unable to understand you while I quoted you saying EXACTLY what she was claiming was your position.

You don't have to be lying. It's possible you really don't understand your position well enough to present it, but I find the complete contradictions in your posts to be laughable.


Looks like you seriously haven't grown up (yet) if you carry on with that sort of behaviour.
Let's see, I can get angry at the clear, obvious, and apparently intentional inconsistencies in your posts or I can laugh at them. I choose to do the latter and my peers wonder what I'm laughing at. What would you have me do? Deny them the opportunity to be equally entertained. Personally, I don't see how anyone cannot see that obvious incompatibility of some of your statements at this point. And then the most amusing part, my mature friend, is that when people questions those inconsistencies they get accused of not being able to understand your oh-so-basic position. If that's what it takes to grow up - to create posts that directly contradict each other and then insult anyone who notices - then I'll be a 31-year-old child, thanks.

Meanwhile, I don't suspect the people who are also reading your posts are going to agree with your assessment. They might think me rude or abrasive, but I doubt there are many onlookers here that don't notice that your claims are counter the evidence, don't take into account the most basic understandings of the field, and don't agree with each other.

Speciation is not necessarily evidence for macroevolution, since it can also be quite neatly explained in terms of creation of a basic type, which has diverged over time and through reproductive isolation into e.g., non-breeding communities. In fact, what we know of speciation would fit better with this concept, since we can see this happening. On the other hand, the idea that speciation provides evidence for macroevolution is like saying churches are evidence for the existence of God.

Anyone see the goalposts move? Anyone?

Not really. At its most basic, many of the complex enzymatic processes now used would be unnecessary. Most of the complex proceses within our own cells are redundant - and we can survive without them. The life acheived is not as robust, but it is alive. Take that to the level of a single-celled organism. How much of the processes can we knock out before the cell ceases to live?

A good question, and I wish we could answer that one, since if we did know the answer, we would really be in a better position to see if abiogenesis would be capable of meeting the criteria. I'm guessing that it would be at least several important ones, such as a cell barrier, a way of generating energy, a way of replicating genetic material, and a way to control cell division--perhaps more. All of these require complex enzymatic processes in modern life. I suppose one question to answer would be how a theoretical (primitive) life could survive with simplified models of these complex processes.

By the way, I suggest that we could not survive without most of the complex processes within our own cells, if only because we have become dependent on them. You talk about cancerous cells as if they somehow manage to survive without most of their major processes. Cancer therapy would not be possible if this were true, particularly drug therapy which is intended to remove only one or a few of the processes in order to kill the cells.



So, I thought that, just maybe, you weren't making things up - that you actually were using a form of RT I've never heard of, so I looked up the Qiagen Reverse Transcriptase kit. Strangely enough, there is no step at 94 degrees listed, at least not until *after* reverse transcription has been carried out at 37 degrees and you wish to deactivate your RT.


Well, on Monday morning, I did have another look at my protocols, and I see that the first step of the RT is performed at 50 degrees C for 30 minutes, to allow for the RT to transcribe the RNA into cDNA, after which the 94 degrees for 3 min step is performed. My apologies for my error. I suppose I should have looked first instead of relying on my memory.

However, it would be interesting to know if the RNA survived the 94 degrees, or if the heating step would rapidly degrade it, as you suggest.




Actually, generally, it is at least five.


Do you mean there are five possible mutations that lead to cancer, or that every cancerous cell has at least five mutations?


Yes, actually, you did. You stated that the controls are absolutely necessary for life. You can go back and look at your own quotes if you would like.


Not *all* of the controls are necessary for life. I stand by my original comment. And there must be some controls that are necessary for life, at least a necessary core. Otherwise life may not be capable of dying.


On further examination, it seems that RNA sequences have been found that catalyze replication of other sequences, leading to speculation on the possibility of RNA sequences that might be able to catalyze their own replication. Of course, to say that it is 'complete fantasy' is a bit silly. If we know that RNA can catalyze the replication of RNA, then a self-replicating RNA isn't a huge logical jump.


Trying to find an RNA polymer in the first place might be a bit hard. In fact, this is probably the biggest problem with abiogenesis, e.g., the development of information without the presence of anything to recognise information and make use of it. It remains a fantasy, because the possibility may only exist in the imaginations of humans (as far as we know).




Oh wait, you're backpedaling. You said that the SLT2 directly predicted against not only abiogenesis, but evolutionary theory. Are you retracting that now? You seem to have added in other factors - not that you or I are aware of all of the factors that may or many not have been present.


Firstly, I didn't mention evolutionary theory in that particular statement, and I'm not sure why you mentioned it. Secondly, I never said that SLT directly predicted against abiogenesis. Thirdly, I never ruled out other factors being present.
You had better explain yourself, Dem.


Both, really. By adhering to the scientific method, the people within science are bound by science.


That's a mite silly, since we humans are never limited to science when we are actually devising new experiments. We use our imaginations for this act, and the imagination is hardly bound by science, even in the act of planning experiments that are useful to science, since at that level it is the thinking human which decides what is possible within science and what isn't. The thought processes must respect the limitations of science, but not necessarily be bound by them, or forbidden to consider concepts that science cannot measure, since science itself actually consists of several assumptions.


From a scientific point of view, such an alternative is irrelevant, as it cannot be investigated by science. It would be no different than complaining that a chemist didn't allow for the "alternative" theory that God personally combined the chemicals in the vial into a new one. Personal beliefs and scientific theories are not the same. The presence of God is always allowed for - simply outside of science.


I think it perfectly OK to attempt to investigate the natural world in a manner that is consistent with a designer. It isn't necessary to demonstrate whether the designer exists, ever, nor to assume anything more about the designer other than to postulate that he/she/it *may* exist, and if so, how does the data look with respect to that concept.

The data only has to be consistent with a designer, not looking for miracles, but looking at e.g. biology. It would mean investigating the natural world, not the supernatural, and is thus respecting the limitations of science. You may not call it science, but that is another issue. The question is, do you think this is possible. If not, why not?

I realize that personal beliefs and scientific theories are not the same. But that really is quite irrelevant to this point.


Nothing in any of our discussions has ever meant anything in the absence of supernatural means. This is what you fail to understand. Because science is bound by the natural, it can only investigate natural explanations for things. This does not mean that anything happened "in the absence of supernatural means". However, even if confronted with supernatural occurrences, science would see whatever happened as having happened naturally, and would interpret the natural world in that light.


But we cannot tell if all things happened naturally. So why embrace a science that is only allowed to interpret data through natural processes? If the truth is that God created, you would be limited in your search, since you won't allow for the truth.

Science is indeed bound to investigating the natural world, but it is certainly capable of holding to ideals that cannot currently be investigated, such as the concept that every cause has an effect. Such a concept is common within science, but has never been tested.

I suggest that, if confronted with an obviously supernatural event, while my approach may seek natural explanations, it would not necessarily conclude natural explanations, since it does not exclude supernatural forces, and would thus be a more robust form of science. At the same time, when confronted with an event that does have naturalistic explanations, it would be capable of discovering them.


So, if it weren't for the fact that you might lose your job, you would throw the scientific method out the window and include God in your science?


Don't be silly. I would only mention God in a nice informal introduction or discussion (if at all, and probably not), not as a detailed part of the methods or results. Many papers do the same with evolutionary theory, in which the theory features in a nice informal introduction, but has little to do with the empirical method featured in the paper.

It's perhaps the feeling of being forbidden to mention God that incites something like a forbidden desire. If the 'restriction' were removed, I may never take advantage of it.

Remember, it's not the lack of the mention of God in a paper that bothers me. I personally reject a commitment to the concept that natural forces can explain everthing. That others have such a commitment is their right, just as it is my right to criticise it.



If you do not inject God into the science, then you are performing science as if God does not exist - plain and simple. It doesn't mean that you have to believe that God does not exist, because your beliefs are not part of your science.


If you wish to do this, go ahead. But why claim that this is the only form of science possible?


Put it this way: I perform experiments in the lab as if my dog does not exist. My dog is not involved in my experiments, so they are carried out as if he does not exist. They would be exactly the same whether I had a dog or not.


But your dog is hardly capable of being responsible for life and the universe, thus it truly is irrelevant to your lab methodology (unless you are too busy worrying about your dog).


If you do not question God in your science, then your science would be the same whether God existed or not. Thus, you perform science as if God does not exist.


Yes, I can see such a form of science is possible, but I would not call it the same. For if God created man as man (i.e., a special act), your form of science would not only fail to allow for that, but it will always come up with an explanation for man that is false.


You said the exact same thing, with words in a different order. There is no data that can only be reasonably interpreted as consistent with any explanation, as one must always continue to question and might find a better explanation as time goes on.


I tried to put the emphasis on the word 'reasonable', which means that other explanations would be allowed, but only on the basis of being reasonable, i.e., how well they explain the data.



Personally? Yes, of course. In science? Absolutely not. Doing such would necessitate making an assumption, within the science, that God exists. It would require injecting God into science.


If that is your only objection to my position, perhaps our conversation is nearly at end, for I think I have learned just about all I can from you (on this topic). Or perhaps there is more.
But you cannot be so worried about assumptions, since there are several others that exist within science.


No, you can't. You must assume that something which could have done the designing exists if you are to investigate the possibility of a designer. No data can point to the presence of a design without the a priori assumption of a being that could be the designer.


At that point, there is no assumption, just a postulation. One doesn't need to assume that God exists if they are only postulating that he exists. The same is true of Santa Claus or any other object of the imagination. (Such is not my position, but perhaps that of an IDer.)


No, you aren't - not if you are investigating anything about what you think was created. Once you make that assumption - a completely untestable one - all data you get will be interpreted in light of the original assumption. If your assumption is wrong, your conclusions will be wrong - and you will never know it, because you cannot test your assumption.


But I have said that I have not assumed that God created through special acts, only that he is capable of it. Thus I continue to allow for more than one possibility.


It would seem to me that any measurable disadvantage would have to be a significant percentage of the total genome. In other words, a creature with an already large genome would tolerate more "excess DNA" than a creature with a smaller genome. Of course, at least in species with chromosomal DNA, if that excess DNA were often passed on with a beneficial trait, the two could cancel each other out.


Is there any species without chromosomal DNA (other than viruses)?


There is all sorts of empirical evidence. You simply don't like it.


Perhaps you could indicate the evidence for something like macroevolution, and I will tell you what I like and what I don't. Perhaps you could also define macroevolution while you are at it.


I don't need any such thing. You are the one trying to disprove a theory. Thus, it is *you* who must demonstrate that evolutionary processes would always result in shrinking genomes. If you cannot demonstrate this, then you have not shown the theory to be incorrect, and it will still stand as a valid theory, as there is no empirical evidence to disprove it.


While I am critical of parts of the theory of evolution, I am certainly not trying to disprove it here. That is beyond me.
I have suggested that all of the modern genomes seem to be either shrinking or in a steady state, with no examples of genome growth (that I am aware of). This is not what we would have expected from evolution theory. Perhaps there is an explanation for this, but I have not heard of it (yet). Please fill me in if you know more.

Furthermore, the processes that lead to shrinking genomes are observed and increasingly understood. On the other hand, the processes that *could* lead to growing genomes (e.g. gene duplication mistakes) are also observed and partially understood, but are not adequate (apparently) to increase genome size. In addition, such processes are not supported by empirical evidence (that I am aware of) when used to explain how they might increase the genome size. Once again, feel free to present the evidence if you know it, and we could discuss it.


Me, Jocabia, Grave, St Curie, Bak, Wes - and that's just in this thread. I've seen numerous others have to correct you in numerous other threads.

I am allowed to make mistakes, am I not? Or does making mistakes mean that all my points are false. You own slate is not clean on that count. Perhaps I have had to correct the others as well. I think making mistakes is a sign of being human, not (necessarily) an indication of deceit or being completely and utterly mistaken.

Or if you mean that since these folks have disgreed with me, that this counts as them having to correct me. That would hardly be fair of you.

Anyone see the goalposts move? Anyone?

Yes, exactly. The really absurd Creationists say that it has to be a change from one 'kind' of species to another to count, without explaining what 'kind' refers to. I didn't think Bruarong was one of them. For most people, speciation is exactly what is referred to by macroevolution.

You can't disprove any explanation without adequate evidence. You can't actually disprove fairies. The way in through which we can reject the notion of fairies is by pointing out the inconsistencies in the explanation for fairies, i.e. the gaps, not to mention that lack of empirical evidence.


I'd quite like to see this... perhaps you are not aware, but the evidence for 'fairies' is at least as good as the evidence for any of the recognised 'gods'... and most of the ways in which people might reject fairies, turn out to be based on misunderstandings of what fairies 'are'...

All of these require complex enzymatic processes in modern life.

But each requires less complexity than it has. We can knock out an enzyme here or there and the process may become less efficient, but it still works.

By the way, I suggest that we could not survive without most of the complex processes within our own cells, if only because we have become dependent on them.

The processes? No. Portions of the processes? Absolutely. It is rare indeed that a knock-out model leads to a lethal disease state in, for instance, a mouse. Usually, some sort of disease state is present, but is not lethal, at least not immediately.

You talk about cancerous cells as if they somehow manage to survive without most of their major processes.

I never claimed that. You specifically referred to the control processes of cell proliferation. I provided an example in which the controls of cell proliferation are removed, but life continues nonetheless.

However, it would be interesting to know if the RNA survived the 94 degrees, or if the heating step would rapidly degrade it, as you suggest.

I never said that heating RNA would rapidly degrade it. I would assume that it would speed up degradation, as heating does with most such molecules, but I doubt you would lose all of your RNA. I simply pointed out that the RT itself - a protein - would be destroyed by such heating.

Do you mean there are five possible mutations that lead to cancer, or that every cancerous cell has at least five mutations?

As a general rule, there will be at least five measurable mutations in a cell before that cell becomes cancerous.

Trying to find an RNA polymer in the first place might be a bit hard. In fact, this is probably the biggest problem with abiogenesis, e.g., the development of information without the presence of anything to recognise information and make use of it.

We have already gone through this. Information doesn't become information until something makes use of it. As such, complexity is what we are talking about, at least at first, not information.

Firstly, I didn't mention evolutionary theory in that particular statement, and I'm not sure why you mentioned it.

That is what this thread is about, is it not? And you started out in this thread by making the statement that evolutionary theory would be "against the predictions of the SLT2." Go back and look at your own first couple of posts.

Secondly, I never said that SLT directly predicted against abiogenesis.

No, but you did say that it directly predicted against evolutionary theory.

Thirdly, I never ruled out other factors being present.

I didn't claim you did. However, the only way you could have made your comment that the SLT2 would predict against evolution is to ignore the presence of other factors.

That's a mite silly, since we humans are never limited to science when we are actually devising new experiments.

We are limited to science when we are performing science. If we step outside of science, we are no longer performing science, and are, in fact, doing something else.

I think it perfectly OK to attempt to investigate the natural world in a manner that is consistent with a designer. It isn't necessary to demonstrate whether the designer exists, ever, nor to assume anything more about the designer other than to postulate that he/she/it *may* exist, and if so, how does the data look with respect to that concept.

If you are interpreting data with respect to the idea of a designer existing, then you are interpreting data with the assumption that a designer exists. As such, you have injected the supernatural into science - something you claim you realize is unscientific.

The only way to find "design" is to assume a designer.

The data only has to be consistent with a designer,

...which is only logically possible if you first assume a designer exists.

I realize that personal beliefs and scientific theories are not the same. But that really is quite irrelevant to this point.

No, it is exactly the point. You said that a person should be able to allow for the God they believe in to do what they believe said God would do. In a personal belief sense, this is absolutely true. In a scientific sense, it is not, as doing so would necessitate assuming an untestable and unfalsifiable God into your science.

But we cannot tell if all things happened naturally. So why embrace a science that is only allowed to interpret data through natural processes?

Because the method is quite useful within natural processes. We know that there may be things it cannot investigate, but such is the limitation necessary to use this logical process. If you want to discuss religion, you go to theology. If you want to discuss morality, you might move to another form of philosophy. Science is a logical process meant to be of use in investigating the natural world. As such, it is bound to the natural world, and can interpret data only in light of the natural world.

If the truth is that God created, you would be limited in your search, since you won't allow for the truth.

Within science, no, you wouldn't. Within your own personal beliefs, you absolutely would. The strength of science is that it works equally well whether God exists or does not exist - whether God interferes or does not interfere. The alternative is to assume one or the other - injecting beliefs about God into science. Instead, God is left out altoghether.

Science is indeed bound to investigating the natural world, but it is certainly capable of holding to ideals that cannot currently be investigated, such as the concept that every cause has an effect. Such a concept is common within science, but has never been tested.

It has been tested numerous times. Thus far, we have yet to see a single effect without a cause. The only untestable assumption in science is that we live in a deterministic universe - that the exact same conditions will always lead to the exact same result. It is this assumption upon which all of the scientific method - the use of inductive logic - is based. Beyond that, the assumptions within certain disciplines of science are all testable and falsifiable, albeit not necessarily with the technology of today.

I suggest that, if confronted with an obviously supernatural event,

Define "obviously supernatural event."

while my approach may seek natural explanations, it would not necessarily conclude natural explanations, since it does not exclude supernatural forces, and would thus be a more robust form of science. At the same time, when confronted with an event that does have naturalistic explanations, it would be capable of discovering them.

There you go injecting the supernatural into science again. And here you claimed that you don't do that. Do make up your mind, please?

It's perhaps the feeling of being forbidden to mention God that incites something like a forbidden desire. If the 'restriction' were removed, I may never take advantage of it.

If you don't like the fact that science is bound to the natural world, maybe you should go for another field of study - like theology, perhaps.

If you wish to do this, go ahead. But why claim that this is the only form of science possible?

You have already agreed that it is the only form of science possible - as injecting the supernatural into science goes outside the scientific method, and thus outside of science. You have already stated that you perform your own science as if God does not exist - by pointing out that God never enters into the equation in your science.

Yes, I can see such a form of science is possible, but I would not call it the same. For if God created man as man (i.e., a special act), your form of science would not only fail to allow for that, but it will always come up with an explanation for man that is false.

Unless you have been lying throughout this thread (which, at this point, wouldn't suprise me in the least), your form of science would also always come up with an explanation that is false in that case. Why? Because you have agreed that God cannot be injected into science.

Your problem is that you want science to the end-all-be-all of study. It is not. It has its limitations, as do all forms of study.

But you cannot be so worried about assumptions, since there are several others that exist within science.

There is one basic assumption within science. Other assumptions may be included, if either backed up or if one is unable to test them at this point, but they must be testable and falsifiable.

At that point, there is no assumption, just a postulation.

The only way it is logically possible to find "design" within data is to assume a designer. Otherwise, one is finding a pattern in the data, but that data is not necessarily designed.

But I have said that I have not assumed that God created through special acts, only that he is capable of it. Thus I continue to allow for more than one possibility.

All of science allows for this possibility - by not bringing God into it at all. God may exist and may not exist - and science will be exactly the same. Thus, within science, you do not allow for any more possibilities than an atheist or agnostic.

Is there any species without chromosomal DNA (other than viruses)?

There are species without chromosomes, or, rather, without more than one chromosome - which is what I was referring to.

Perhaps you could indicate the evidence for something like macroevolution, and I will tell you what I like and what I don't.

You really should follow the conversation a little better. That particular portion of our discussion had nothing to do with macroevolution.

While I am critical of parts of the theory of evolution, I am certainly not trying to disprove it here. That is beyond me.

You claim that evolutionary theory is inconsistent with the data we have. Making such a statement (if you could back it up) would disprove the theory. If you would like to rescind the statement, by all means, do so.

I have suggested that all of the modern genomes seem to be either shrinking or in a steady state, with no examples of genome growth (that I am aware of). This is not what we would have expected from evolution theory.

Why not?

On the other hand, the processes that *could* lead to growing genomes (e.g. gene duplication mistakes) are also observed and partially understood, but are not adequate (apparently) to increase genome size.

Really? And the evidence for this is? Please do show me where you have found that it is impossible to increase genome size through gene duplication. Keep in mind the presence of 4-5 globin genes within mammalian genomes - which appear to have been the products of gene duplication.

I am allowed to make mistakes, am I not?

Everyone is allowed to make mistakes. But your arguments are nearly always based in mistakes - mistakes which you then proceed to argue over and over and over and over again in later threads, even when your misunderstandings have been pointed out to you in great length.

Anyone see the goalposts move? Anyone?
Hell, i FELT 'em move! :)

I have suggested that all of the modern genomes seem to be either shrinking or in a steady state, with no examples of genome growth (that I am aware of). This is not what we would have expected from evolution theory.I don't see why not. You don't need to increase the size of the genome to increase complexity of an organism. As I said before, we have less genes than certain simple organisms (e.g. the Amoeba Dubia has a genome about 200 times ours).
Gene regulation is at least as important. A more efficient cellular machinery can cut down on the amount of genes needed. It might be interesting to note we have far more different proteins than genes coding for them. Just looking at the genome is therefore a bit shortsighted.

Some point mutation constitute neither a loss nor gain, but simply a change in information.

Agreed. That would be a neutral mutation, and actually these are possibly the majority of mutations that exist within living organisms.


And of course 'information' is a laden terms. More bases in the DNA doesn't mean it has more usefull information. We have less genes that a lot of seemingly simpler organisms. Genetics is only part of the story.
Of course that doesn't change the question of how changes devellop.


DNA bases does not equal information. It is the arrangement, ie., the sequence of base pairs that is recognised as having a message. This is information. And there is a relatively new area of science devoted to it, called bioinformatics. One of their goals is to distinguish DNA containing information from DNA which seems to have no information (other than the message that it contains no information).


If an actual new trait has develloped (rather than the bacteria that already had it being selected), then I'd yes it does.

In that context, what I meant as evidence for macroevolution was data that cannot reasonable be explained without considering it a process of macroevolution. If the data can be explained very neatly (i.e. just as well) by an alternative theory, then the data can be considered consistent with both competing theories, but not evidence for one against the other. It was in this context that I was referring to macroevolution and speciation.

And so, when looking at new traits, we need to look at the process by which they have arisen. If creation theory can adequately explain the trait, then the emergence of this trait cannot be said to be evidence for evolutionary theory, against creation theory.

I suggest that creation theory would predict that new species and new traits would emerge through a process of a loss of information (e.g. through mutation), as does evolutionary theory, but not through the development of novel complex processes, as evolutionary theory predicts.


The observation of beneficial genetic changes gives evidence that it's a mechanism that does in fact occur. Moreso it occurs under the circumstances evolution theory predicts, selective pressure (slowly poisoning the environment of the bacteria, giving those who cope better the advantage).


Creation theory would predict the same outcome. Natural selection selects those organism with the fittest features. Where creation theory *may* differ is in the processes by which these advantages come to the species.


Reality TV provides ample evidence to that point ;)

It would provide examples of humans lacking intelligence, perhaps, but not evidence that humans are incapable of intelligence.


Selection needn't be natural per se though. Or you can be more liberal with what you call natural. If intelligence gets you a better job and a better mate than the competition, there's still positive selection. Whether you want to call it natural or not.

No, you are not allowed any selection that might develop greater intelligence potential in the *general* population once human intelligence is 'floating free' of the selection that brought it about in the first place.


Not entirely true. If you have siblings, they share (for most species on our planet) abotu 50% of your traits. If you die childless, but in doing so sufficiently increase their chances of survival/reproduction, your traits also likely survive. Which can account for altruistic behaviour in nature.

That would be kin selection, and I know this does occur, but it does not account for altruistic behaviour. For example, the people who helped the Jews during the holocaust often did so in spite of being unrelated genetically or socially, of receiving no material benefit, frequently not even being religious (no hope of reward in the after life) or doing so because of religious motivation, at great risk to their own families, being aware of the great risk, etc. Such behaviours would seem to defy natural selection explanations. The only naturalistic explanation I've heard is that somehow human intelligence is capable of actions beyond the limitations of the processes that helped to develop it.


e.g. By serving their queen, bees can ensure the next generation of bees will be much like them. 50% of their genes will be passed on, the same as if they would reproduce themselves, but a hive is much more resilient than a single bee, and so the probability of that 50% being passed on is much greater.

That would explain why bees have survived from generation to generation, but not how they developed from a lone insect into a highly organised community of insects, with their own language and ability to recognise bees from other hives as 'foreign', and having a single 'queen' bee which is the only one capable of reproduction.

But they'd still be the same species in the latter case wouldn't they? Something has to change on the phenotype level, which has to be preceeded by some change at the genetic level if it is to be a heriditary trait.

It depends on your definition of a species. Some people argue that if a hybrid is possible from two different species (something like a mule from a cross between a horse and a donkey), regardless of infertility, those two parent species should not be considered separate species. Lions (Panthera leo) and tigers (Panthera tigris) are capable of producing hybrids. Does that mean they are really a separate species? If they are, then speciation has occurred, but it would be that which is predicted by both creation theory and evolution theory.


The existence of god does not predict churches, looking for churches and not findign them would not dicredit the theory of godly existence.
However not finding speciation, would discredit the theory of evolution. Therefore it provides eveidence; a possible falsification has failed.

Yes, good point. My analogy failed because it included an example of something (God) which we cannot test for through science. My original point was that one can only claim evidence for evolutionary theory (against alternatives) if the data can be reasonably explained in terms of only evolutionary theory.

Thus, if you insist that speciation is macroevolution, and if I am to use your terms, I would say that macroevolution, in the case of speciation, does not contradict creation theory, or even a six day creation and a very young world.

Intelligent design. Thankyou bruarong for your intelligent comments. It's good to see that someone with an understanding in cell biology and genetics has the patience to discuss this. Unfortunately, I've only done elementary work in geneics, and I don't feel qualified to enter this debate; my degree is in anatomy and physiology. However on the subject of cell physiology, I would like to refute the completely useless comment that demipublicents1 made:

"But each requires less complexity than it has. We can knock out an enzyme here or there and the process may become less efficient, but it still works."

This total rubbish, made up from a lack of knowledge. You cannot knock out enzymes here and there and merely have a less efficient system. For an enzymatic chain to work (i.e. production of adrenaline via dopamine), the first enzyme in the chain must modify the substrate for the second enzyme to work, and so on. Also, take a look a the electron transport chain in mitochondria, which ends with an incredibly complex proton turbine pump for producing ATP. Adenosine has to be phosphorylated (x3) to produce ATP (a high energy molecule), and the enzymes that phosphorylate adenosine are proteins coded for in the DNA. DNA translation/transcription process requires ATP to work. This is merely one of thousands of examples of the irreducible complexity of the body systems, tissues and cells, that has the indelible imprint of intelligent design.

Can I throw in a curve ball? The van Allen radiation belts are belts of radioactive particles that surround the earth and act as a shield to protect us from the sun's intense solar wind radiation. They were detected in 1957 by Explorer 1 (1st American satellite). These belts are radioactive particles, and as such, decay at a certain, fixed rate (as anyone who's done high school physics will know). Judging from the current level of radiation and the rate of decay, scientists discovered that the levels of radiation 100,000 years ago would have been so high that the earth would not have supported life, and 10 million years ago, the earth would have been in the liquid state, due to the immense heat from the radiation. Seeing as Evolution requires 15 billion years for all the evolution to occur (the chances of a good mutation occuring are become more and more scarce, so they need to give evolution ridiculously immense amounts of time just to make it believeable), the evidence seems to preclude evolution from being the cause of our immense complexity.

DNA bases does not equal information. It is the arrangement,But all DNA bases are in an arrangement. So that's a moot distinction.

In that context, what I meant as evidence for macroevolution was data that cannot reasonable be explained without considering it a process of macroevolution. If the data can be explained very neatly (i.e. just as well) by an alternative theory, then the data can be considered consistent with both competing theories, but not evidence for one against the other. It was in this context that I was referring to macroevolution and speciation.Evidence needn't be distinctual. Something can be evidence for two competing theories.
Although I still have no idea what you mean by 'creation theory' and speciation in that context. (I haven't read most of the post leading up to the ones I responded to.)
Of course, everything imaginable is consistent with "God did it", so it lacks a certain appeal of explanation.

And so, when looking at new traits, we need to look at the process by which they have arisen. If creation theory can adequately explain the trait, then the emergence of this trait cannot be said to be evidence for evolutionary theory, against creation theory. Creation would equally well explain the non-emergence as emergence of a trait, as far as I understand it. So in fact the observation of it means nothing with regards to creation, whereas it does have relevance to evolution. Certainly it is consistent with both, but the opposite would only be inconsistent with evolution.
I wouldn't mind hearing about what would be falsifiable in creation theory, and if anyone has tried experiments on that.

I suggest that creation theory would predict that new species and new traits would emerge through a process of a loss of information (e.g. through mutation), as does evolutionary theory, but not through the development of novel complex processes, as evolutionary theory predicts.But if the organism is more adapted by the trait, then it's also evolution. Even so, I don't see how you can justifiably call it a 'loss of information' if a new trait is created. Whereas it may be true that you need less information to encode the genome, the usefull information in it is greater.
In fact, a completely random genome would require the most information to encode it, it has the highest entropy. However it will most likely not encode for any genes. And contrariwise, if all of the DNA codes for genes, you can get a much, compact description of it (compression).
That's why I'm hesitant to use the term 'information' in this context. What is relevant is the 'meaning' of the DNA (in the context of the cellular machinery that uses it), not the entropy of the base sequence.

Creation theory would predict the same outcome. Natural selection selects those organism with the fittest features. Where creation theory *may* differ is in the processes by which these advantages come to the species.Would it be a fair characterization that creation theory would encompass all of evolutionary theory and then some?
In science less is more; we want the theory that explains as much of what is, and as little of what isn't. If a theory explains both, it really doesn't tell us much.
And of course aside fromt hat, there is the pragmatic view that we might want a theory that we can exploit. And in that sense, certainly, evolution has proved quite fruitfull.

No, you are not allowed any selection that might develop greater intelligence potential in the *general* population once human intelligence is 'floating free' of the selection that brought it about in the first place.I disagree. Any selection is valid, regardless of which has brought intelligence to the point it is.
If IQ were a valid measure of intelligence, and we set up a eugenics campaign to kill/neuter everyone with an IQ under 120, it would certainly drive up intelligence. Quite unnaturally I might add. So while it's free of natural selection, it may not be free of other kinds of selection.

That would be kin selection, and I know this does occur, but it does not account for altruistic behaviour. For example, the people who helped the Jews during the holocaust often did so in spite of being unrelated genetically or socially, of receiving no material benefit, frequently not even being religious (no hope of reward in the after life) or doing so because of religious motivation, at great risk to their own families, being aware of the great risk, etc. Such behaviours would seem to defy natural selection explanations.Not really. You are confusing side effects with the beneficial traits. Forgive the example, but being able to pee standing up is not the function of our penis, its function is so we can impregnate women, peeing standing up is a side effect.
Altruism towards non-kin is like peeing standing up, it's a side effect. Generally the people that altruism will effect are kin. And when it isn't, the effect is not detrimental. So the benefits outweigh (supposedly) the negative aspect of the side effects.
And of course there is some interaction with other effects, like sexual selection and the handicap principle (showing fitness by non-beneficiary behaviour).

That would explain why bees have survived from generation to generation, but not how they developed from a lone insect into a highly organised community of insects, with their own language and ability to recognise bees from other hives as 'foreign', and having a single 'queen' bee which is the only one capable of reproduction.The single queen might be a parochial rather than a universal. In fact, some species of bee do have multiple queens (they also enslave another bee hive rather than forming their own, given the chance).
As for organization, that's simple enough to explain. A more organized hive has a better chance of survival than a chaotic one. Evolution works on many levels, in fact you can look at a hive as a single organism. And some even look at earth as a single organism (Gaia theory).
That leaves why solitary bee ancestors started to form hives in the first place. There's strength in number of course. Possibly families of bees turned up that kept living together and things grew from there. Division of labour comes as a natural improvement of a society, as does more advanced communication. And also a lot of complicated behaviour simply emerges when lots of simple behaviours interact.
If you're looking for a gene by gene adaptation though, I'm afraid I must disappoint you. I don't know that much about bees :p

This total rubbish, made up from a lack of knowledge. You cannot knock out enzymes here and there and merely have a less efficient system.

But can you have a system that performs another function ?

This is merely one of thousands of examples of the irreducible complexity of the body systems, tissues and cells, that has the indelible imprint of intelligent design.

Irreducible complexity as defined by Behe is a logical fallacy: it can never been shown to exist in a biological system. This is illustrated by the fact that there are *no* examples of irreducible complexity currently used by the more sensible ID people; though some are still dumb enough to use the old flagellum posterchild.

This is merely one of thousands of examples of the irreducible complexity of the body systems, tissues and cells, that has the indelible imprint of intelligent design.Actually, it's faux example. The complexity is not necessarily irreducible. It just isn't reducible to a subset of itself. It's a chicken and egg problem, ignoring that other things lay eggs (albeit not generally chicken eggs).
It is entirely reasonable to consider that there were other cellular processes that through evolution lead to additional ones we have now, then the old ones became obsolete (since the new ones do the same task better) and got selected away.
As an analogy, we no longer use stone age technology, but it was necessary to get us to where we are now. The machines we have now can't be made without the machines we have. But that doesn't warrant the assumption they must always have been around. Luckily archeology has done a better job here finding some evidence of the stone age than cellular biology seems to have done so far for its equivalent.

Judging from the current level of radiation and the rate of decay, scientists discovered that the levels of radiation 100,000 years ago would have been so high that the earth would not have supported life, and 10 million years ago, the earth would have been in the liquid state, due to the immense heat from the radiation.I seriously doubt this, but for the sake of argument, could you give a link to an article, or provide the facts used to derive this conclusion?

Seeing as Evolution requires 15 billion years for all the evolution to occurActually, it doesn't take nearly that long. Even including the emergence of the first organisms (evolution only applies after there's already life), it doesn't have to take longer than 4 billion.
Also bare in mind we have an enitre universe of planets where all sorts of life might emerge. That earthly life might not be the only sort, etc. I can recommend the book "What does a martian look like" (by Ian Stewart and Jack Cohen) It gives an interesting perspective on the probability of life in the universe. The arguments for and against, and common miscomprehensions of the problem.

the evidence seems to preclude evolution from being the cause of our immense complexity.What evidence?

What is speciation if not what skeptics call macroevolution?

http://www.talkorigins.org/faqs/macroevolution.html

In evolutionary biology today, macroevolution is used to refer to any evolutionary change at or above the level of species. It means the splitting of a species into two (speciation, or cladogenesis, from the Greek meaning "the origin of a branch") or the change of a species over time into another (anagenesis, not nowadays generally used). Any changes that occur at higher levels, such as the evolution of new families, phyla or genera, is also therefore macroevolution, but the term is not restricted to the origin of those higher taxa.

Microevolution refers to any evolutionary change below the level of species, and refers to changes in the frequency within a population or a species of its alleles (alternative genes) and their effects on the form, or phenotype, of organisms that make up that population or species.

Another way to state the difference is that macroevolution is between-species evolution of genes and microevolution is within-species evolution of genes.

Speciation IS macroevolution. Hmmmm... our resident scientist marks yet ANOTHER major misunderstanding of a basic concept.

Please, explain what macroevolution is if speciation does not count, my friend?

I consider this a case of semantics. I do not argue against speciation, and if you wish to call speciation an example of macroevolution, then to use your terms, I do not argue against that case of macroevolution.

However, if you are interested in what I mean by macroevolution (which is different from the Wikipedia version), then I say that macroevolution is the where the currently understood processes like mutation (as a source of variation), natural selection, speciation, etc. (microevolution), are thought to be adequate to account for the development of e.g. prokaryotes into eukaryotes, reptiles into birds, fish into mammals, and primitive Hominidae (I'm not allowed to call them apes) into humans.

What that means is I need to develop the idea of 'basic types'. That means that every creature falls into basic types. If there was a creator who created life, and if he created life according to their basic types, then ever since that time, the processes of speciation may have formed new species within those basic types. My task would then be to determine the parameters of those basic types, to determine which animals belong to which basic type. Currently, the classification Genera forms a general indication of basic types, but I understand that this does not strictly hold true, since both the Ponginae (apes) and Homo are considered in the same Genus. My theory would then predict that speciation occurs within basic types, but that one basic type would not evolve into a completely new basic type (i.e. macroevolution).

One way of testing for basic types would be to look at the possibility of creating hybrids between difference species within the basic types, e.g. lions and tigers. I predict that species from different basic types would be incapable of forming hybrids, due to the genetic differences being to great. An interesting, but unethical, experiment would be to see if humans and chimps could form a hybrid. (I'm not sure if this experiment has been done, and although interesting, I consider it too unethical. ) The idea is that no hybrid could be formed, since chimps do not belong to the same basic type as humans.

I should say that 'basic types' is not my own idea (taxonomy is not specifically the focus of my area of research, though I do encounter it from time to time), but that I discovered it when reading through the literature of an IDer who was a taxonomist.

One way of testing for basic types would be to look at the possibility of creating hybrids between difference species within the basic types, e.g. lions and tigers. I predict that species from different basic types would be incapable of forming hybrids, due to the genetic differences being to great. So, if I understand this correctly, species that can form hybrids belong to the same basic type, and species that can't form hybrids belong to different basic types?
If so, then what of species where species A can form a hybrid with species B, B with C, but C not with A. (And yes, this does in fact occur.) Taxonomy is problematic for several reasons, and occurences like this is one.

Evolution doesn't lack emperical evidence. We could still use more, but that is always true. There is more evidence for evolution than there is for the 2nd Law of Thermodynamics and you seem to be quite comfortable with that theory.


I think that the theory of evolution is lacking evidence in several parts. For example, the concept that mitochondria are the remnants of symbiotic bacteria is seriously lacking empirical evidence. There is some data that can be explained as being consistent, (e.g. homology in the genes) although very little. For the most part, the processes of such an occurrence has no evidence, I would say.

And I think it is a mistake of you to assert that there is more evidence for the SLT than for evolutionary theory. Are you sure you don't want to take that one back? Perhaps every material exchange that we observe can be explained in terms of the SLT. Evolutionary theory, however, cannot even explain what life is, let alone how the processes that we know are operating in nature are supposed to explain how life can develop novel features--or perhaps it can at the blackboard level, but not at the level of chemical reactions--and thus is no comparison to the SLT.

Any high school student could have criticised your statement by saying that at least we can observe the processes of SLT, and the effects, while evolutionary theory consists of mere explanations in many parts.




I quoted you stating that you are unwilling to explore the evolutionary tree because you believe it doesn't exist. You can try to take that out of context, but at the time we weren't talking about you actually changing your field. You clearly stated that you don't think it's worth pursuing because it doesn't follow your beliefs. And you very much implied it when you said you'd let the naturalist continue to explore evolution.


I think this is a matter of you taking my quote out of context. In fact, you seem to have devoted a great deal of time digging up my previous posts, in order to find inconsistencies in my position, in order to show that I have been lying. I do have control over the words in my post, but I have not control over your interpretation of them. And it doesn't contribute to an intelligent debate to assume that I have been lying, based on your interpretation of my posts.

I suggest that rather than taking this approach, simply try to deal with my posts in this thread, and leave off running back to previous threads and taking my posts out of context. I can tell you that I am not trying to fool anybody, nor would I gain any pleasure out of converting anyone to my point of view, or winning a foolish argument that you are trying to turn this debate into.

And now, to address the point in contention, I have clearly explained that my reasons for not searching for an evolutionary tree have to do with my personal point of view. Every scientist has a personal point of view, and it will influence the area of science they focus on. I find evolutionary trees mildly interesting, but not enough to change my area of research. And I have no problem with your choice to uncover evolutionary trees, if that was your choice, though I retain the right to criticise you for it.


Yes, in fact, you did say that. You said you were unwilling to even consider that evidence might exist and thus would avoid looking for it. I don't have to accuse you of anything. I quoted you.

I have never said that I have been unwilling to consider that the evidence for evolutionary trees or anything else belonging to evolutionary theory might be true. Provide the quote showing where I have, and show how you have not taken it out of context.


You can keep saying it's a problem of our understanding, but as of yet I haven't seen a remotely adequate explanation of your hangup with naturalism (basically anyone who doesn't refuse to do proper science is a naturalist with you, except you won't actually say that outright, but just imply it in a dozen or so posts). I haven't seen you adequately explain the other inconsistencies in your posts. You've accused Dem of being unable to understand you while I quoted you saying EXACTLY what she was claiming was your position.


Problem in basic comprehension is one problem. A mad addiction to winning (at any price, it seems) a debate could be another. I don't know what your problem is, but it seems to manifest itself in placing the blame on me.


You don't have to be lying. It's possible you really don't understand your position well enough to present it, but I find the complete contradictions in your posts to be laughable.


But you didn't think of that when you asserted that I was lying. Instead, you went ahead with it anyway. Why was that? What sort of human would rather assume a case of deceit rather than of confusion?


Let's see, I can get angry at the clear, obvious, and apparently intentional inconsistencies in your posts or I can laugh at them. I choose to do the latter and my peers wonder what I'm laughing at. What would you have me do? Deny them the opportunity to be equally entertained.

Whatever you do, don't blame me for your apparent weakness to control your emotions or your immaturity.


Personally, I don't see how anyone cannot see that obvious incompatibility of some of your statements at this point. And then the most amusing part, my mature friend, is that when people questions those inconsistencies they get accused of not being able to understand your oh-so-basic position. If that's what it takes to grow up - to create posts that directly contradict each other and then insult anyone who notices - then I'll be a 31-year-old child, thanks.

But when I address the issue that my posts have not been incompatible, you take your anger as evidence that they are, rather than reproducing my posts and explaining how my interpretation of them is contradictory, or how my interpretation of my posts is somehow less trustworthy that your interpretations.


Meanwhile, I don't suspect the people who are also reading your posts are going to agree with your assessment. They might think me rude or abrasive, but I doubt there are many onlookers here that don't notice that your claims are counter the evidence, don't take into account the most basic understandings of the field, and don't agree with each other.

You are rude and abrasive, and that itself is an indication that your judgement of this situation is suspect, since rudeness it unnecessary and does not contribute to an intelligent discussion.

So, if I understand this correctly, species that can form hybrids belong to the same basic type, and species that can't form hybrids belong to different basic types?
If so, then what of species where species A can form a hybrid with species B, B with C, but C not with A. (And yes, this does in fact occur.) Taxonomy is problematic for several reasons, and occurences like this is one.

That is a good point. My answer is that the fact that C cannot form a hybrid with A is not absolutely an indication that they do not belong in the same basic type category. But so long as hybrids form from A and B, and from B and C, then this would be sufficient grounds for at least a preliminary classification. The degree of relatedness is established, albeit indirectly.

One can imagine a case where every (or most) basic types could be related through hybrids in a chain like fashion. For example, suppose all the intermediates between modern humans and the pre-human ape-like creature were all alive today, and all these could form hybrids with their immediate ancestors. In this way, humans would be considered in the same basic type as apes. Taken further, if it could be shown that every modern life form was shown (through a hybrid forming ability) to be related, resulting in the categorization of all of life into a single basic type, then my theory would be discarded as useless.

This is an example of a testable hypothesis that is the result of a postulation of the creation of basic types.

I think that the theory of evolution is lacking evidence in several parts. For example, the concept that mitochondria are the remnants of symbiotic bacteria is seriously lacking empirical evidence. There is some data that can be explained as being consistent, (e.g. homology in the genes) although very little. For the most part, the processes of such an occurrence has no evidence, I would say.How much, and what sort of evidence would you want?

Evidence that mitochondria and plastids arose via ancient endosymbiosis of bacteria is as follows:

* Both mitochondria and plastids contain DNA, which is fairly different from that of the cell nucleus, and that is similar to that of bacteria (in being circular and in its size).
* They are surrounded by two or more membranes, and the innermost of these shows differences in composition compared to the other membranes in the cell. The composition is like that of a prokaryotic cell membrane.
* New mitochondria and plastids are formed only through a process similar to binary fission. In some algae, such as Euglena, the plastids can be destroyed by certain chemicals or prolonged absence of light without otherwise affecting the cell. In such a case, the plastids will not regenerate.
* Much of the internal structure and biochemistry of plastids, for instance the presence of thylakoids and particular chlorophylls, is very similar to that of cyanobacteria. Phylogenetic estimates constructed with bacteria, plastids, and eukaryotic genomes also suggest that plastids are most closely related to cyanobacteria.
* DNA sequence analysis and phylogenetic estimates suggests that nuclear DNA contains genes that probably came from the plastid.
* Some proteins encoded in the nucleus are transported to the organelle, and both mitochondria and plastids have small genomes compared to bacteria. This is consistent with an increased dependence on the eukaryotic host after forming an endosymbiosis. Most genes on the organellar genomes have been lost or moved to the nucleus. Most genes needed for mitochondrial and plastid function are located in the nucleus. Many originate from the bacterial endosymbiont.
* Plastids are present in very different groups of protists, some of which are closely related to forms lacking plastids. This suggests that if chloroplasts originated de novo, they did so multiple times, in which case their close similarity to each other is difficult to explain. Many of these protists contain "secondary" plastids that have been acquired from other plastid-containg eukaryotes, not from cyanobacteria directly.
* These organelle's ribosomes are like those found in bacteria (70s).

A possible secondary endosymbiosis (i.e. involving eukaryotic plastids) has been observed by Okamato & Inouye (2005). A heterotrophic protist ingested a green alga, which lost its flagella and cytoskeleton, while the host switched to photosynthetic nutrition and gained the ability to move towards light.

I've never actually looked it up myself, but it's a common argument of IDers that supposedly proves evolution wrong. So, out of curiosity, I finally looked it up.
http://en.wikipedia.org/wiki/Second_law_of_thermodynamics


...hang on. I thought the IDers said it had to do with a system's complexity. Did I just kick the supports out from under one of the most pervasive and largest arguments of IDers? Or is there more to it, and I'm just being a simplistic idiot?

So...IDers...actual learned folks...what do you have to say on this?


It just means that everything gets shittier over time - barring divine intervention.
As if you could not learn that from looking at a council estate over time.

But each requires less complexity than it has. We can knock out an enzyme here or there and the process may become less efficient, but it still works.

That would be true in the case of redundant pathways, or situations where more than one chemical pathway is present. Hardly an option in a the majority of bacterial cases, certainly not in a primitive cell.



The processes? No. Portions of the processes? Absolutely. It is rare indeed that a knock-out model leads to a lethal disease state in, for instance, a mouse. Usually, some sort of disease state is present, but is not lethal, at least not immediately.


Rare? That would be an exaggeration.


I never claimed that. You specifically referred to the control processes of cell proliferation. I provided an example in which the controls of cell proliferation are removed, but life continues nonetheless.


In a cancerous cell, the controls of cell proliferation are altered, not removed.


I never said that heating RNA would rapidly degrade it. I would assume that it would speed up degradation, as heating does with most such molecules, but I doubt you would lose all of your RNA. I simply pointed out that the RT itself - a protein - would be destroyed by such heating.


My point is that the major contributing factor to the degradation of RNA is RNases, as opposed to chemical instability.


As a general rule, there will be at least five measurable mutations in a cell before that cell becomes cancerous.


Fair enough.


We have already gone through this. Information doesn't become information until something makes use of it. As such, complexity is what we are talking about, at least at first, not information.


Complexity is useless unless it can be recognised as information, would you agree?


That is what this thread is about, is it not? And you started out in this thread by making the statement that evolutionary theory would be "against the predictions of the SLT2." Go back and look at your own first couple of posts.


I did have a look at the first couple of posts, and there is nothing there about evolutionary theory. It seemed to be all about abiogenesis, with some references to E. coli to show how abiogenesis was unlikely. Not once did I mention evolutionary theory being at odds with the SLT, at least not in the first couple of posts. However, since you are making this claim, I suggest you provide proof or admit your error.


No, but you did say that it directly predicted against evolutionary theory.


Perhaps you ought to provide that post.


I didn't claim you did. However, the only way you could have made your comment that the SLT2 would predict against evolution is to ignore the presence of other factors.


A knowledge of STL does not imply that either abiogenesis or evolution are false or impossible, it is the recognition that a combination of all the known forces do not make abiogenesis likely, nor particular aspects of evolutionary theory. That does not mean we should consider them false or impossible, since our knowledge is not perfect.


We are limited to science when we are performing science. If we step outside of science, we are no longer performing science, and are, in fact, doing something else.


I was referring to the fact that in order to be good at science, we need to use our imagination. Using the imagination might be considered to be outside of science by you, I'm not sure, but it is in the imagination that we make postulations, recognise concepts, plan experiments, etc.


If you are interpreting data with respect to the idea of a designer existing, then you are interpreting data with the assumption that a designer exists. As such, you have injected the supernatural into science - something you claim you realize is unscientific.

The only way to find "design" is to assume a designer.


The conclusion of your approach means that you think you cannot discover truth about the material world so long as one is not focussing exclusively on the material world, while I am arguing that such exclusiveness is unnecessary.

I have agreed that it is unscientific to expect that science can measure the supernatural, but I have not agreed that it is unscientific to allow for the supernatural. It's not your form of science perhaps, but that really doesn't bother me.

I think that there is nothing wrong with assuming that there *could* be a designer, and using science to investigate the material world in a manner that is consistent with that assumption.


No, it is exactly the point. You said that a person should be able to allow for the God they believe in to do what they believe said God would do. In a personal belief sense, this is absolutely true. In a scientific sense, it is not, as doing so would necessitate assuming an untestable and unfalsifiable God into your science.


But if one remembers that God is untestable and unfalsifiable, i.e, the limitations of science, then what is your problem?


Because the method is quite useful within natural processes. We know that there may be things it cannot investigate, but such is the limitation necessary to use this logical process. If you want to discuss religion, you go to theology. If you want to discuss morality, you might move to another form of philosophy. Science is a logical process meant to be of use in investigating the natural world. As such, it is bound to the natural world, and can interpret data only in light of the natural world.


If you want your science to be limited in such a manner, then you are welcome to it, as far as I can see. As for me, I will continue to investigate the natural world in search of truth about the natural world. I do not agree with your limitations on the interpretation of the data.


It has been tested numerous times. Thus far, we have yet to see a single effect without a cause.

But it is not absolutely testable, since we don't even know if there can be an effect without a cause, or if there can be a cause without an effect. Nor would we necessarily recognise it if there was. Thus, the concept is not testable. Rather it is assumed. We find all sorts of evidence to support our assumption, but we don't even know if it is possible to find evidence against it.


The only untestable assumption in science is that we live in a deterministic universe - that the exact same conditions will always lead to the exact same result. It is this assumption upon which all of the scientific method - the use of inductive logic - is based. Beyond that, the assumptions within certain disciplines of science are all testable and falsifiable, albeit not necessarily with the technology of today.


It's enough that there is even one assumption within the scientific method (and yet it still yields results) to suggest that having assumptions need not impair the search for truth.


Define "obviously supernatural event."


That would be an event which cannot be described by the laws of nature, in which the result is quite different from a situation what would have happened if the laws of nature had not been interferred with.
(Although it may not be obvious to people who have ruled out such a possibility. Our perception of reality is really a reflection of the state of our minds.)




There you go injecting the supernatural into science again. And here you claimed that you don't do that. Do make up your mind, please?


You claim that my approach is injecting God into science. I claim that it isn't an injection, but that God has been there all along, an assumption upon which to begin one's search for truth in the material world. God is there before science, so it is fair to say that science is the latecomer. If there is any injection, it would be the concept that God must be excluded from consideration. For me, He is the assumption that makes science possible. The order and consistency that we assume in science is because of God.

And I don't like the way you try to show that I am changing my mind, when you know that I am only seeking a way to explain my position clearly. You try to give the impression that I am changing my mind by using different definitions and different interpretations to me. That is rude. Please stop it.


If you don't like the fact that science is bound to the natural world, maybe you should go for another field of study - like theology, perhaps.


I don't mind at all the empirical method is bound to the natural world. I simply refuse to let my imagination be bound to the natural world.


You have already agreed that it is the only form of science possible - as injecting the supernatural into science goes outside the scientific method, and thus outside of science. You have already stated that you perform your own science as if God does not exist - by pointing out that God never enters into the equation in your science.


I'll repeat myself yet again. Science can only investigate the natural world, while the idea that God may have been responsible for events in the natural world will mean that those events cannot be investigated, but the results of those events can, and should be.


Unless you have been lying throughout this thread (which, at this point, wouldn't suprise me in the least), your form of science would also always come up with an explanation that is false in that case. Why? Because you have agreed that God cannot be injected into science.


Since you have defined the 'injection of God into science' in a way that I do not agree with (and never have), any insistence that I have been lying will need to be carefully re-evalutated. If you can find any evidence that I have agreed with your definition, then I have been mistaken (though not necessarily lying). On the other hand, the lack of any evidence that I have agreed with your definition will imply that you have been either dishonest or mistaken in your claims of my dishonesty.


Your problem is that you want science to the end-all-be-all of study. It is not. It has its limitations, as do all forms of study.


Rubbish. I simply want my science to be capable of searching for truth in a material world, rather than committed to something that could be a myth, e.g. evolutionary theory (and if it is a myth, science will never realize, so long as it is only modified and never questioned as true).


All of science allows for this possibility - by not bringing God into it at all. God may exist and may not exist - and science will be exactly the same. Thus, within science, you do not allow for any more possibilities than an atheist or agnostic.


I think it depends. Science that allows for God may discover something about nature that naturalistic science cannot. Thus I cannot agree that both forms of science will be exactly the same.


You claim that evolutionary theory is inconsistent with the data we have. Making such a statement (if you could back it up) would disprove the theory. If you would like to rescind the statement, by all means, do so.


No, it wouldn't disprove the theory, so long as the theory could modified. Where the theory could not be modified, then you would have a hole in the theory, not necessarily a disproven theory. Remember, we have already agreed that absolute proof is beyond the capability of science, particular the history of origins.



I have suggested that all of the modern genomes seem to be either shrinking or in a steady state, with no examples of genome growth (that I am aware of). This is not what we would have expected from evolution theory.


Why not?


Because anyone reading up evolutionary theory would be led to expect that the evolutionary process should still be continuing, and thus some of the genomes of modern life ought to reflect this. There is nothing in evolutionary theory that expects that all of the modern genomes would lack evidence of growth, though the observation does not disprove evolutionary theory, but it does require an extra explanation.


Really? And the evidence for this is? Please do show me where you have found that it is impossible to increase genome size through gene duplication. Keep in mind the presence of 4-5 globin genes within mammalian genomes - which appear to have been the products of gene duplication.


It is of course possible for a genome to increase in size due to replication, but apparently such events are not sufficient to cause an overall increase in the genome, otherwise we would have detected general genome growth in modern life.

As for the multiple homolgous globin genes in mammals, science may not be able to tell us how such genes came to be duplicated. Interpretation of the observation consistent with evolutionary theory (or creation theory, perhaps) may lead us to conclude duplication, but remember that it may be no more than an appearance--more to do with the position of the observer than with reality.


Everyone is allowed to make mistakes. But your arguments are nearly always based in mistakes - mistakes which you then proceed to argue over and over and over and over again in later threads, even when your misunderstandings have been pointed out to you in great length.

If you define my position of assuming God as a mistake, then I can see your point, though I do not agree with you. However, from my point of view, you are making mistakes, which I am trying to point out to you over and over again, even when I point out your misunderstandings at great length.

I think that the theory of evolution is lacking evidence in several parts. For example, the concept that mitochondria are the remnants of symbiotic bacteria is seriously lacking empirical evidence. There is some data that can be explained as being consistent, (e.g. homology in the genes) although very little. For the most part, the processes of such an occurrence has no evidence, I would say.

Someone already addressed this. I've noticed that "I don't know about it so it must not exist" tends to be your general rule for how to assess a theory.

And I think it is a mistake of you to assert that there is more evidence for the SLT than for evolutionary theory. Are you sure you don't want to take that one back? Perhaps every material exchange that we observe can be explained in terms of the SLT. Evolutionary theory, however, cannot even explain what life is, let alone how the processes that we know are operating in nature are supposed to explain how life can develop novel features--or perhaps it can at the blackboard level, but not at the level of chemical reactions--and thus is no comparison to the SLT.

Ha. Amusing. More evidence against your claims of what you do for a living. Evolutionary theory can explain all of those things. And has. Not only that, it has shown ample evidence for the explanations. What you mean to say is it can't prove it. You require a level of proof that science does not and never has required. You do so because otherwise you'd have to admit that the mountains of evidence that support current theory cannot be ignored.

SLT is observed but it has the same limitations. We don't know that SLT has always stood anymore than we know that radioactive decay has been constant. We only know what we've observed. However, that's enough for you if you like the theory and not enough if it's a theory that disagrees with your "God did it" hypothesis.

Any high school student could have criticised your statement by saying that at least we can observe the processes of SLT, and the effects, while evolutionary theory consists of mere explanations in many parts.

Evolutionary processes have been observed and you've been given examples. You are again misusing the term. Evolutionary theory and all of its fruit is the most challenged theory in history and so far it has stood up to all challenges. If you can, scientifically prove it wrong or present a better alternate theory. You'll be the most famous scientist in the world if you do so, but you better have more evidence than 'well, I don't like evolutionary theory'.

It's interesting that 'any high school student' can criticize my statement that is in line with the majority of the scientific community that recognizes that evolution HAS been observed. Amazing how a theory that could be debunked by "any high school student" can't be debunked by you. What's that say?


I think this is a matter of you taking my quote out of context. In fact, you seem to have devoted a great deal of time digging up my previous posts, in order to find inconsistencies in my position, in order to show that I have been lying. I do have control over the words in my post, but I have not control over your interpretation of them. And it doesn't contribute to an intelligent debate to assume that I have been lying, based on your interpretation of my posts.

Prove it. You have access to the thread. I read the entire thing. Bring quotes to show we were talking about something else. I showed your entire post and what post you were replying to. I linked to the thread. I welcome you or anyone else to read that thread. Prove I did any such thing as taking it out of context or quit lying.

I'd be upset to if I was in one thread claiming not to have any claims about what God did and didn't do and then in another I was saying that I was so sure that God created bacteria as bacteria that I would never be willing to explore other possiblities. This isn't a court of law. When the evidence is against you, you can't try to get that evidence thrown out on a technicality. Show you didn't say that, or quit lying.

I suggest that rather than taking this approach, simply try to deal with my posts in this thread, and leave off running back to previous threads and taking my posts out of context. I can tell you that I am not trying to fool anybody, nor would I gain any pleasure out of converting anyone to my point of view, or winning a foolish argument that you are trying to turn this debate into.

Ha. Why? Do your posts in other threads not have to do with this subject? Many posters here don't forget everything one said in another thread simply because it ended. When you're talking to your coworkers about a subject you discussed the day before and they mention what you said during that discussion do you respond with "you can't hold me to what I said yesterday"?

You said it. I quoted it. I gave the context. You're welcome to refute the context with evidence, something you haven't done. I brought it into this thread because when GnI mentioned that you'd said some of thing you'd said in that thread you acted as if you hadn't said them until I provided evidence that you were either wrong or being dishonest. Get upset if you like, but that thread very much contradicts some of your claims in this thread so it is quite germaine to your credibility. Were I you, I would want that thread to disappear as well. It's not going to happen.

And now, to address the point in contention, I have clearly explained that my reasons for not searching for an evolutionary tree have to do with my personal point of view. Every scientist has a personal point of view, and it will influence the area of science they focus on. I find evolutionary trees mildly interesting, but not enough to change my area of research. And I have no problem with your choice to uncover evolutionary trees, if that was your choice, though I retain the right to criticise you for it.

Yes, we know and that is why you're not scientist. Scientists don't avoid looking for evidence that might contradict their view on things. You weren't talking about your field of research in that quote. You were saying blatantly that you don't think it exists and that only naturalists would look for such a thing because they refuse to accept the truth. Something you clearly stated again in this thread when I reposted that statement.

And feel free to criticize, but if your criticism is "you're close-minded because you continue to look for evidence instead of refusing to explore any and all possible explanations", well, expect to be laughed at.

I have never said that I have been unwilling to consider that the evidence for evolutionary trees or anything else belonging to evolutionary theory might be true. Provide the quote showing where I have, and show how you have not taken it out of context.

I quoted it several times in this thread and in context it's worse not better. If you'd like to show the context that makes it say something different feel free. I read that whole thread and it's not there. But hey, just claim it means something different that is says with no evidence and perhaps we all won't notice.

Admittedly, you did eventually backpedal in that thread as well and even claimed you do look for evidence, but in this thread you went right back to stating the opposite.

I have to take it out of context somewhat because I can't quote the entire thread. I love how your idea of rebutting a statement is to ask for something impossible.

Problem in basic comprehension is one problem. A mad addiction to winning (at any price, it seems) a debate could be another. I don't know what your problem is, but it seems to manifest itself in placing the blame on me.

At any price? You mean at the price of pointing out obvious contradictions and pointing out that you have misused the term 'evolution' throughout every thread you've used it in. Pointing out intentional misdirections like suggesting we evolved from apes and then when called out on it, saying you knew it was wrong but didn't care. Yes, pointing out your intentional and clear contradictions, misuses of terms, misunderstanding of the basic concepts of the discussion and misdirections is winning at all costs. I'm so embarrassed for not letting your complete and utter lack of continuity slide. A good debator would allow you to simply say things that are wrong and mislead people without calling you out. Because, well, mentioning that your intentionally misleading people or that you're describing a concept completely wrong is just rude.

But you didn't think of that when you asserted that I was lying. Instead, you went ahead with it anyway. Why was that? What sort of human would rather assume a case of deceit rather than of confusion?

You admitted to misleading people earlier. All evidence suggest it's not accidental. You have several times admitted that being honest is not at the top of your priorities.

I didn't assume deceit initially. I assumed confusion and then you acted as if assuming you mistakingly referred to apes as an ancestor is ridiculous and that it was intentional. I won't make that mistake again. Now, unless shown otherwise I will assume your mistakes are intentional, since you jumped all over me and Dem when we assumed otherwise in another thread. I try to take your preferences into account.

I understand the theory of evolution is that all existing life forms are derived from other life forms through the processes of mutation and natural selection. While that doesn't exactly say that humans evolved from 'lesser' animals (insert apes or monkeys or whatever you jolly will like, it makes no real difference), this it what it means. And that is completely different from your example about Jesus, because meaning of the Bible is that He is God, not a jerk.

Emphasis mine.

Science can disprove things, and it does find out a good deal of stuff about our world through the null hypothesis, etc., but one ought to be careful about what science can and can't do. For example, if there is an assumption within evolutionary theory that cannot be tested, for example, the assumption that homology equals common ancestry, and the natural conclusion that humans evolved from apes, then this assumption cannot be proven wrong through science. In this way, much of the explanations one hears in evolutionary theory simply cannot be proven wrong. It is on equal footing with belief in the smurfs or fairys or God when it cannot be proven wrong.

Emphasis mine.

When pressed you said you won't describe evolution the way we want to hear it, as if what you were saying isn't patently false.

http://forums.jolt.co.uk/showpost.php?p=10416529&postcount=297
Nit pick, really. Perhaps I do not always describe evolution the way that you want to hear it. But I will try to keep your preferences in mind.

You call the difference between describing the theory accurately and using a typical Creationist propaganda claim as a preference and a nitpick.

Whether you call the pre-historic creature an ape or something else is hardly an important detail. The point is that it was probably a strong, hairy, smelly, not-so-intelligent animal, according to evolutionary history. I have no problems calling it an ape, even if it was a different ape to the modern animals. Is that why you have called me a liar? Come on, Jocabia. I doubt anyone is reading these posts except for people like you and me and Willamena and Dem and a couple others. I'm not trying to persuade 'the masses out there' with emotionally stirring arguments. I think everyone here are already evolutionists.

In other words, "yes, I know what I'm saying is wrong and possibly misleading, but I don't mind because why bother accurately describing it?" In other posts, you claimed you were simply being lazy or didn't want to take the time to state it properly. Interesting how you don't have time to state it correctly but you have time to repeatedly state it incorrectly and defend the improper use of the term 'ape' and 'monkey'.

But hey, it's my fault for looking at the old threads and incorporating your statements into your current claims. I'm silly that way.

Whatever you do, don't blame me for your apparent weakness to control your emotions or your immaturity.

Good thing you're always polite. I accept the blame for my behavior. And, your posts are amusing so I share them with other people who would like to be amused. Do you honestly think scientists aren't going to laugh when you claim we evolved from apes? Seriously?

But when I address the issue that my posts have not been incompatible, you take your anger as evidence that they are, rather than reproducing my posts and explaining how my interpretation of them is contradictory, or how my interpretation of my posts is somehow less trustworthy that your interpretations.

Your interpretations? If you did not contradict yourself you have the worst grasp of the English language I've ever seen. I demonstrated direct contradictions. Contradiction you insulted people for noticing. You several times accused Dem of simply being unable or unwilling to understand your posts while she replied to things you explicitly said. Your explanations require you to ignore the context of the other thread where they were stated. I didn't and won't ignore that context. You made it quite clear in the other thread that you are unwilling to explore certain avenues of science while accusing people who do explore those avenues of being close-minded. You stated EXPLICITLY that your beef with certain areas of science is that there is "a complete absense of God" while claiming you aren't arguing that God should have a place in science. Golly, I wish I could simply understand your posts better so I could better understand how a complaint like "a complete absense of God" in science wouldn't mean that you think God should be used as an argument in science.


You are rude and abrasive, and that itself is an indication that your judgement of this situation is suspect, since rudeness it unnecessary and does not contribute to an intelligent discussion.

Ha. I'm saving this one. This is the best one yet. If only I could manage to accuse everyone who notices my contradictions of being unable to understand, then I would be more polite like you, no? Gosh, I sure wish I continue to redefine terms until it makes me right and everyone else wrong. Basic terms like 'evolution', 'macroevolution', 'life', 'polite', etc. We've given several examples of you being rude. I'm glad that like a true hypocrite you hold yourself to a completely different set of standards than everyone else.


Some other claims from other threads for those interested in where this poster is coming from -

http://forums.jolt.co.uk/showthread.php?p=10949382&highlight=bacteria#post10949382
There is no reason to attack a theory like gravity, because it mostly 'works', and where it doesn't, nobody comes out with blazing guns trying to defend it. Nor is the theory of gravity often used to remove God from someone's world view. It isn't taught in order to make kids athesists.

Apparently, evolution is taught to children not as science, but to make kids 'athesists'. Yes, it's just a typo, but it's a funny typo. Have a sense of humor. The point is that you believe that teaching scientific theory is an attack on Christianity, but evolution never states anywhere that God doesn't exist or that Creation did not occur. You actually complain that evolutionary theory has a complete lack of God. Not mentioning God in a science classroom is not going to make children into Atheists.

This is also evidence that though you claimed you accept the possibility that evolution is the process by which God created man, your argument that teaching evolution is teaching atheism counters that. Saying that evolution and atheism are intrinsically connected is clearly close-minded as it rejects the possiblity of evolution as a tool of our Creator.

In that context, what I meant as evidence for macroevolution was data that cannot reasonable be explained without considering it a process of macroevolution. If the data can be explained very neatly (i.e. just as well) by an alternative theory, then the data can be considered consistent with both competing theories, but not evidence for one against the other. It was in this context that I was referring to macroevolution and speciation.

That is absolutely true. However, there is no competing scientific theory that explains the data just as well.

If creation theory can adequately explain the trait, then the emergence of this trait cannot be said to be evidence for evolutionary theory, against creation theory.

"Creation theory" is inherently unscientific, as it assumes the existence of an untestable and unfalsifiable God. Thus, while evidence for evolutionary theory cannot be evidence against Creation, science cannot find any evidence for Creation (without injecting God into science, which you have already admitted is not permissable.)

My original point was that one can only claim evidence for evolutionary theory (against alternatives) if the data can be reasonably explained in terms of only evolutionary theory.

That makes no sense, especially within the context of the scientific method. A given piece of evidence may equally support more than one theory. It is only when one theory has garnered much more evidence than any other that it becomes the leading theory. As of right now, there is no scientific theory that rivals evolutionary theory. There are some religious ideas that people have, but they are, by definition, outside of science.

However on the subject of cell physiology, I would like to refute the completely useless comment that demipublicents1 made:

"But each requires less complexity than it has. We can knock out an enzyme here or there and the process may become less efficient, but it still works."

This total rubbish, made up from a lack of knowledge. You cannot knock out enzymes here and there and merely have a less efficient system.

Actually, with most enzymes, you can. The reason for this is the extreme amount of redundancy in most of our processes.

This is merely one of thousands of examples of the irreducible complexity of the body systems, tissues and cells, that has the indelible imprint of intelligent design.

The idea of irreducible complexity is an illogical leap. You have to assume that the process has always and will always be the same. You cannot look at a process or construct *now*, and say, "Look here, if I remove this little piece, it stops working. Guess that means it is irreducibly complex." To do so is to ignore the fact that those pieces may have done something entirely different in a different system - and that the system itself could now be optimized.

These belts are radioactive particles, and as such, decay at a certain, fixed rate (as anyone who's done high school physics will know).

Anyone who has done high school physics knows that radioactive particles do not decay at a fixed rate. They follow an exponential decay.

Anyone who has done high school physics also knows that, only in a closed system can you use the calculated exponential decay. I would hardly suggest that the van Allen belts are a closed system. There is no reason whatsoever to assume that there is no influx of material.


That would be true in the case of redundant pathways, or situations where more than one chemical pathway is present. Hardly an option in a the majority of bacterial cases, certainly not in a primitive cell.

The point is that the amount of complexity we now see in life is not necessary for life to continue. All of those redundant pathways make life more robust (and often more fragile, at the same time), but they are not all necessary.

Rare? That would be an exaggeration.

No, it really wouldn't. I've seen all sorts of knockout models. The ones that are embryonic lethal or are lethal early in life are very rare when compared to those that seem to cause no measurable difference, only cause a difference in stressed states, or cause a disease state that is not immediately lethal.

In a cancerous cell, the controls of cell proliferation are altered, not removed.

Some of them are removed by the mutations - processes that were working no longer do anything.

My point is that the major contributing factor to the degradation of RNA is RNases, as opposed to chemical instability.

....which is irrelevant to the original point made - which was that RNA is naturally less stable than DNA, even in the absence of enzymes.

Complexity is useless unless it can be recognised as information, would you agree?

Not really. There are many uses for complexity. Information is simply one of them - and the minute something "reads" the complexity, it becomes information.

Quote:
Originally Posted by Dempublicents1
That is what this thread is about, is it not? And you started out in this thread by making the statement that evolutionary theory would be "against the predictions of the SLT2." Go back and look at your own first couple of posts.

I did have a look at the first couple of posts, and there is nothing there about evolutionary theory.

The topic referred to evolutionary theory.

In your second post - the first where you addressed the original question, you made the following statement:

iven that life is such a powerhouse of energy, is it reasonable to suggest that this sort of energy could have become so concentrated and potent AGAINST the predictions of the SLT2?

I suppose this might be referring to abiogenesis, rather than evolutionary theory and the complexity that might have been derived through evolutionary processes, but one way or another it clearly states that the processes are "against the predictions of the SLT2."

I was referring to the fact that in order to be good at science, we need to use our imagination. Using the imagination might be considered to be outside of science by you, I'm not sure, but it is in the imagination that we make postulations, recognise concepts, plan experiments, etc.

But each of those postulations, concepts, experiments, etc. must be within science to be considered part of science.

The conclusion of your approach means that you think you cannot discover truth about the material world so long as one is not focussing exclusively on the material world, while I am arguing that such exclusiveness is unnecessary.

I never said any such thing. I simply pointed out that you cannot use SCIENCE without focussing on the material world, because the material world is the only area in which science can be used.

I have agreed that it is unscientific to expect that science can measure the supernatural, but I have not agreed that it is unscientific to allow for the supernatural. It's not your form of science perhaps, but that really doesn't bother me.

All of science allows for the supernatural to either exist or not exist. However, to remain within science, an experiment/explanation/etc. must work equally well in the presence or absence of the supernatural. Anything else is assuming one of those positions - both unscientific assumptions.

I think that there is nothing wrong with assuming that there *could* be a designer, and using science to investigate the material world in a manner that is consistent with that assumption.

Doing so injects the supernatural into science - something you have already admitted is not permissable.

But if one remembers that God is untestable and unfalsifiable, i.e, the limitations of science, then what is your problem?

If you know that God is untestable and unfalsifiable, then the existence or nonexistence of God cannot be an assumption upon which your science is based.

If you want your science to be limited in such a manner, then you are welcome to it, as far as I can see. As for me, I will continue to investigate the natural world in search of truth about the natural world. I do not agree with your limitations on the interpretation of the data.

It has nothing to do with what I want. The methods of science are, by definition, limited in this manner. You have admitted as much in this thread.

It's enough that there is even one assumption within the scientific method (and yet it still yields results) to suggest that having assumptions need not impair the search for truth.

That assumption is the assumption upon which the entire method is based. Extra assumptions made within a given application of the scientific method must be testable and falsifiable.

Your statement is like saying, "We assume in mathematics that the axioms upon which mathematics is based are true. Thus, it would be perfectly acceptable to assume that x always equals y.

That would be an event which cannot be described by the laws of nature, in which the result is quite different from a situation what would have happened if the laws of nature had not been interferred with.

Do you know all of the laws of nature? If you do not (and you do not), then this definition is useless. You would never know if a given event could not be described by the laws of nature.

You claim that my approach is injecting God into science. I claim that it isn't an injection, but that God has been there all along, an assumption upon which to begin one's search for truth in the material world. God is there before science, so it is fair to say that science is the latecomer. If there is any injection, it would be the concept that God must be excluded from consideration. For me, He is the assumption that makes science possible. The order and consistency that we assume in science is because of God.

You are once again confusing personal belief with scientific assumptions. Your personal beliefs are irrelevant (or at least should be) to the way you conduct science.

And I don't like the way you try to show that I am changing my mind, when you know that I am only seeking a way to explain my position clearly. You try to give the impression that I am changing my mind by using different definitions and different interpretations to me. That is rude. Please stop it.

You are clearly contradicting yourself, time and time again. If you cannot describe your position without contradictions, then perhaps you need to reexamine your position.

I don't mind at all the empirical method is bound to the natural world. I simply refuse to let my imagination be bound to the natural world.

No one is asking you to.

I'll repeat myself yet again. Science can only investigate the natural world, while the idea that God may have been responsible for events in the natural world will mean that those events cannot be investigated, but the results of those events can, and should be.

But, within science, said events cannot be attributed to God, as doing so involves making the scientific assumption that God exists. Because science cannot investigate the existence or nonexistence of God, the scientific method must operate independent of either choice.

Since you have defined the 'injection of God into science' in a way that I do not agree with (and never have),

So you don't think that explaining a process by saying, "God did it," is an injection of God into science? You don't think that basing an entire scientific theory in the assumption that God exists is an injection of God into science?

Pray tell, what exactly would have to be done to inject God into science, then?

Rubbish. I simply want my science to be capable of searching for truth in a material world, rather than committed to something that could be a myth, e.g. evolutionary theory (and if it is a myth, science will never realize, so long as it is only modified and never questioned as true).

Science is capable of searching for truth in the material world. It simply does so outside of the question of whether or not the supernatural exists.

Meanwhile, evolutionary theory is not above question - and no one has suggested that it is. Every scientific theory is open to question.

I think it depends. Science that allows for God may discover something about nature that naturalistic science cannot.

All science allows for God - by not addressing the question at all. Science, performed correctly, works just as well regardless of whether or not the supernatural exists. One cannot assume that God exists or that God does not exist within science.

No, it wouldn't disprove the theory, so long as the theory could modified.

If modification is necessary, then the theory as it stands has been disproven.

Where the theory could not be modified, then you would have a hole in the theory, not necessarily a disproven theory.

If a theory cannot be modified to fit contradictory data, then it has been disproven. This is exactly how science progresses.

Because anyone reading up evolutionary theory would be led to expect that the evolutionary process should still be continuing, and thus some of the genomes of modern life ought to reflect this.

Shrinking genomes would still be evidence of the evolutionary process continuing. Evolutionary theory does not equate to "growing genomes". It simply describes the processes by which life changes over time.

It is of course possible for a genome to increase in size due to replication, but apparently such events are not sufficient to cause an overall increase in the genome, otherwise we would have detected general genome growth in modern life.

You do realize that, on the time scale of evolutionary theory, we have been watching genomes for an incredibly short period of time, right? To say that we would necessarily have already found something that you personally think is necessary is no different from those who claim that evolutionary theory is disproven by the fact that we haven't found a fossil for every form of every species that has ever existed.

As for the multiple homolgous globin genes in mammals, science may not be able to tell us how such genes came to be duplicated. Interpretation of the observation consistent with evolutionary theory (or creation theory, perhaps) may lead us to conclude duplication, but remember that it may be no more than an appearance--more to do with the position of the observer than with reality.

Any scientific theory may be incorrect. This is why we continue to test and question them.

You are rude and abrasive, and that itself is an indication that your judgement of this situation is suspect, since rudeness it unnecessary and does not contribute to an intelligent discussion.

I believe this is a PERFECT example of the 'ad hominem fallacy' in action.

Jocabia is 'mean', so his argument must be wrong...

I would hardly suggest that the van Allen belts are a closed system. There is no reason whatsoever to assume that there is no influx of material.

Just as a further point... there is also no reason to assume that we are discussing a 'constant feature'... we could be talking about a relatively new phenomenon...

I believe this is a PERFECT example of the 'ad hominem fallacy' in action.

Jocabia is 'mean', so his argument must be wrong...

I am rude and abrasive at times, even occasionally to the wrong people (masked apology), but what's amazing is how one can call me immature in the same post where he says anyone who is rude is unreliable. And, of course, if he likes I can show he has been openly rude to just about every respected poster on NS. Well, not TCT but I haven't seen him yet. I've seen DK, VO2, Dem, you, me, TSW, just to start a list. That's an awful lot especially considered the varying styles of those posters. I mean, I'm abrasive, but not all of those people are.

I am rude and abrasive at times, even occasionally to the wrong people (masked apology), but what's amazing is how one can call me immature in the same post where he says anyone who is rude is unreliable.

You can be volatile at times... but then, who can't?

I have to feel responsible for this, of course... since it was you that 'saved' me from that same trap... :)

I was just being amazed by a textbook example of the 'ad hominem fallacy' at work... I don't believe I'd previously seen one quite SO 'formula'.

Literally: "Person X is such-and-such, thus, Person X's argument is broken".

You can be volatile at times... but then, who can't?

I have to feel responsible for this, of course... since it was you that 'saved' me from that same trap... :)

I was just being amazed by a textbook example of the 'ad hominem fallacy' at work... I don't believe I'd previously seen one quite SO 'formula'.

Literally: "Person X is such-and-such, thus, Person X's argument is broken".

Me? Really? Then can you regurgitate my argument back at me, because I feel like I need saving these days. I'm not sure what happened but I feel like a schoolbus driver these days.

Me? Really? Then can you regurgitate my argument back at me, because I feel like I need saving these days. I'm not sure what happened but I feel like a schoolbus driver these days.

I wish I could recall the wording... :)

Seriously, though... I distinctly remember you pointing out to me that my acidic edge (and sarcastic barbs) might be harming my overall presentation.

At that point... you were... well, you were the good cop to my bad cop, I guess. Of course - I think I was a MUCH 'badder' cop than you are, my friend. :)

Maybe that's it? Maybe I need to start being an asshole again, so you can play Mr Nice Guy? :D

I wish I could recall the wording... :)

Seriously, though... I distinctly remember you pointing out to me that my acidic edge (and sarcastic barbs) might be harming my overall presentation.

At that point... you were... well, you were the good cop to my bad cop, I guess. Of course - I think I was a MUCH 'badder' cop than you are, my friend. :)

Maybe that's it? Maybe I need to start being an asshole again, so you can play Mr Nice Guy? :D

Honestly, I don't know what it is. I don't remember people just blatantly contradicting themselves and then acting like people who notice the contradiction are too dumb to understand the nuances of their argument. There's Nord, Bru and Alabamamississippi in three seperate threads making three seperate very odd arguments with generally the same flaws. Was it always like this and I just didn't notice at first.

It seemed to me like earlier on there was a lot higher quality of people arguing the other side. These days I haven't seen a good argument except in the thread where the lot of us couldn't agree on how to deal with birth defects caused by negligence. What happened to the deeply convicted but very reasonable and methodical anti-rights folks?

Honestly, I don't know what it is. I don't remember people just blatantly contradicting themselves and then acting like people who notice the contradiction are too dumb to understand the nuances of their argument. There's Nord, Bru and Alabamamississippi in three seperate threads making three seperate very odd arguments with generally the same flaws. Was it always like this and I just didn't notice at first.

It seemed to me like earlier on there was a lot higher quality of people arguing the other side. These days I haven't seen a good argument except in the thread where the lot of us couldn't agree on how to deal with birth defects caused by negligence. What happened to the deeply convicted but very reasonable and methodical anti-rights folks?

Maybe we scared them off?

It has always been like this, I'm afraid... although there have been the OCCASSIONAL flashes of brilliance in the 'enemy camp'... ("Personal Responsibilit", was pretty 'sweet' I seem to recall).

Also - a lot of the people you argued with when you first got here... are now people you might consider 'on your side'... Dem, UT, Willamena, Straughn, (the oft-lamented Iakeokeo), myself, etc. Not that I'm claiming any of us are particularly brilliant... it just means that most of your 'regular opposition' has been modifed by your arguments, or has modified your arguments.

We could always start the old "Are we born as Atheists?" topic again... :)

Maybe we scared them off?

It has always been like this, I'm afraid... although there have been the OCCASSIONAL flashes of brilliance in the 'enemy camp'... ("Personal Responsibilit", was pretty 'sweet' I seem to recall).

Also - a lot of the people you argued with when you first got here... are now people you might consider 'on your side'... Dem, UT, Willamena, Straughn, (the oft-lamented Iakeokeo), myself, etc. Not that I'm claiming any of us are particularly brilliant... it just means that most of your 'regular opposition' has been modifed by your arguments, or has modified your arguments.

We could always start the old "Are we born as Atheists?" topic again... :)

Well, remember when I used to argue with what I considered to be the less, how do I say this politely, understanding Christians about how they treat others? I gave some of them a hard time, but do you actually think the guys I used to debate with on such things are anywhere near the quality, or lack thereof, of a Whittier or the like?